ID: 1049090349

View in Genome Browser
Species Human (GRCh38)
Location 8:140509965-140509987
Sequence CAGGGAGCACATTTTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049090349_1049090352 -10 Left 1049090349 8:140509965-140509987 CCTCTGCCAAAATGTGCTCCCTG No data
Right 1049090352 8:140509978-140510000 GTGCTCCCTGTCTCAGTAAAGGG No data
1049090349_1049090355 3 Left 1049090349 8:140509965-140509987 CCTCTGCCAAAATGTGCTCCCTG No data
Right 1049090355 8:140509991-140510013 CAGTAAAGGGCTCTTTACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049090349 Original CRISPR CAGGGAGCACATTTTGGCAG AGG (reversed) Intergenic
No off target data available for this crispr