ID: 1049090352

View in Genome Browser
Species Human (GRCh38)
Location 8:140509978-140510000
Sequence GTGCTCCCTGTCTCAGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049090349_1049090352 -10 Left 1049090349 8:140509965-140509987 CCTCTGCCAAAATGTGCTCCCTG No data
Right 1049090352 8:140509978-140510000 GTGCTCCCTGTCTCAGTAAAGGG No data
1049090348_1049090352 0 Left 1049090348 8:140509955-140509977 CCAATTCAAACCTCTGCCAAAAT No data
Right 1049090352 8:140509978-140510000 GTGCTCCCTGTCTCAGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049090352 Original CRISPR GTGCTCCCTGTCTCAGTAAA GGG Intergenic
No off target data available for this crispr