ID: 1049090608

View in Genome Browser
Species Human (GRCh38)
Location 8:140511272-140511294
Sequence CGGGGGCGGTGTCCGAGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049090601_1049090608 -4 Left 1049090601 8:140511253-140511275 CCGCGCCGGGCCTCGCACTCGGG 0: 1
1: 0
2: 1
3: 12
4: 113
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090591_1049090608 23 Left 1049090591 8:140511226-140511248 CCCCCGCCAGGCTCTCGGCTGCC 0: 1
1: 0
2: 3
3: 47
4: 973
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090589_1049090608 27 Left 1049090589 8:140511222-140511244 CCCGCCCCCGCCAGGCTCTCGGC 0: 1
1: 0
2: 4
3: 39
4: 443
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090592_1049090608 22 Left 1049090592 8:140511227-140511249 CCCCGCCAGGCTCTCGGCTGCCG 0: 1
1: 0
2: 1
3: 29
4: 186
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090596_1049090608 17 Left 1049090596 8:140511232-140511254 CCAGGCTCTCGGCTGCCGGTTCC 0: 1
1: 0
2: 1
3: 17
4: 158
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090605_1049090608 -9 Left 1049090605 8:140511258-140511280 CCGGGCCTCGCACTCGGGGGCGG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090587_1049090608 28 Left 1049090587 8:140511221-140511243 CCCCGCCCCCGCCAGGCTCTCGG 0: 1
1: 1
2: 2
3: 45
4: 388
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090590_1049090608 26 Left 1049090590 8:140511223-140511245 CCGCCCCCGCCAGGCTCTCGGCT 0: 1
1: 0
2: 1
3: 39
4: 314
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090593_1049090608 21 Left 1049090593 8:140511228-140511250 CCCGCCAGGCTCTCGGCTGCCGG 0: 1
1: 0
2: 3
3: 21
4: 198
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090599_1049090608 2 Left 1049090599 8:140511247-140511269 CCGGTTCCGCGCCGGGCCTCGCA 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94
1049090595_1049090608 20 Left 1049090595 8:140511229-140511251 CCGCCAGGCTCTCGGCTGCCGGT 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG 0: 1
1: 0
2: 0
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049090608 Original CRISPR CGGGGGCGGTGTCCGAGCGT CGG Intergenic
901242875 1:7704972-7704994 CGGGGGCGGGGCCGGGGCGTGGG + Intronic
903349950 1:22711327-22711349 CGGGGGCGGCGAGCGCGCGTGGG - Intronic
906114520 1:43347830-43347852 CGGGGGATGTGTCGGAGCATTGG - Intronic
912353990 1:109041115-109041137 CGGGGGCGGGGGGCGAGGGTAGG - Intronic
915586906 1:156848890-156848912 CGGGGGCGGGGCCGGAGCGGGGG - Intronic
917205946 1:172571812-172571834 CCGGGGCGGTGCCCGGGCGGGGG - Intronic
919891997 1:201982569-201982591 CGGGGGCGGGGCCCGCGCGGCGG + Intronic
920912984 1:210234264-210234286 CGGGGGTGGGGTCCGAGGTTTGG - Intronic
1062774649 10:135356-135378 CGGCGGCGGGGTCCGGGCGGGGG + Intronic
1065101284 10:22335238-22335260 CGGAGGCGATGTCCCAGCCTCGG - Intergenic
1072700911 10:97640838-97640860 CGGGGGCGCGGTCCGAGTGGCGG + Exonic
1074130229 10:110567656-110567678 TGGGGGCGGAGTCCGCGCCTCGG - Intergenic
1077184331 11:1229566-1229588 CGGGGGCGGTGTCCTGGAGCAGG + Intronic
1077317608 11:1926296-1926318 CTGGGGCGGTGGCCGCGCCTGGG + Intronic
1081870587 11:46381161-46381183 CTGGGGCGGTTTCCGCGGGTGGG - Exonic
1104376177 12:128267087-128267109 CGGGGGCGGGGCCCGGGCGGGGG + Intergenic
1104736493 12:131138683-131138705 CGGGGGCGGAGTGCGAGAATGGG - Intronic
1106995057 13:35471287-35471309 CGAGGGCGGTGTCGGCGCGAGGG + Intronic
1114007760 14:18332830-18332852 CAGTGGCGGTGTCCGACCCTGGG - Intergenic
1114450505 14:22822282-22822304 CGGTGGCTGGGTCCGAGCTTGGG - Intronic
1121313679 14:92948783-92948805 CGTGGGCGGCGCCCGGGCGTGGG - Intronic
1126134632 15:45378425-45378447 CGGGTGCGGTGTCTGCGCGGCGG - Exonic
1129763934 15:78149325-78149347 CAGGGGCGGGCTCCGAGCGTGGG + Exonic
1132640568 16:976449-976471 TGGGGGCGGTGTCTGAGACTTGG - Intronic
1133115839 16:3577503-3577525 CGGGGGCGGTGACCAAGCCAGGG - Intergenic
1133292829 16:4734232-4734254 CGGGGGCGGTGCCCCGGCGAGGG - Intronic
1136460596 16:30407865-30407887 CCGGGGCTGTGCCAGAGCGTGGG + Intronic
1137731460 16:50693536-50693558 CAGGGGCGGGGTCCGGGCGGGGG + Intergenic
1141959063 16:87392499-87392521 CGGGGCCGGGGTCCGAGCTGTGG + Intronic
1143510903 17:7394548-7394570 CGGGGCCGGGGTCCGAGCTCGGG - Exonic
1146183074 17:30709460-30709482 CGGGGGCGGCGTCAGAGCGCCGG - Intergenic
1148323846 17:46772095-46772117 CGGGGGCGGGGTGCAAACGTGGG + Intronic
1149313817 17:55421290-55421312 CGGGGGCGGTGCCCGGGGCTGGG + Intronic
1150273673 17:63882473-63882495 CGGGGGCGGGGGCGGGGCGTGGG + Intergenic
1154529700 18:15331133-15331155 CAGTGGCGGTGTCCGACCCTGGG + Intergenic
1160763707 19:797973-797995 CGGGGGCAGAGTCCGGGCGGCGG - Intronic
1161029311 19:2050624-2050646 CGGGGTCGGTGTGCGAGGATGGG - Intronic
1161689066 19:5720276-5720298 AGGGGGCGGAGTTCGAGCATCGG + Exonic
1162975721 19:14206308-14206330 CGGGGGCGGCGTCAGAGCGCCGG + Intergenic
1163859333 19:19732924-19732946 CGGGGCCAGTGTCCGAGGGGAGG - Intronic
1166831331 19:45641501-45641523 CGGGGACGGTGCCAGAGCCTTGG - Intronic
1167555585 19:50193182-50193204 TGGGGGCGGTGTCTGAGCAGAGG + Intronic
1168241693 19:55092067-55092089 CGGAGGCGGAGTCTGAGCGAGGG - Intronic
925274541 2:2639421-2639443 CGGGGGCGGCTTCCCAGCGTGGG + Intergenic
925984825 2:9207011-9207033 CAGCGGCGGTGTCCGAGCGGCGG + Exonic
926018481 2:9474659-9474681 CGGGGCGGGAGGCCGAGCGTCGG - Intronic
926154966 2:10448527-10448549 CGGGGGCGGGGGCCACGCGTGGG - Intergenic
927679267 2:25129337-25129359 CGGGGGCGGGGGCGGGGCGTGGG + Intronic
929075686 2:38077094-38077116 CGGAGGCGGCGGCCGAGGGTGGG + Intronic
933751204 2:85602846-85602868 CGTGGGCGGTGTCCCAACTTCGG + Intronic
938528793 2:132162573-132162595 CAGTGGCGGTGTCCGACCCTGGG + Intronic
940316708 2:152335110-152335132 CGGGGGCGGGGGCCGGGCGCCGG + Intergenic
942240966 2:173964228-173964250 CGCGGGCGGGGTCGGAGCGTTGG + Intronic
948751554 2:240136187-240136209 CGGCGGGAGTCTCCGAGCGTGGG - Exonic
1169231221 20:3889815-3889837 CGGGGACAGTGTCCGCGCGCGGG - Intronic
1176023109 20:62972713-62972735 CGGGGGAGGGGGCCGGGCGTGGG + Intergenic
1176077349 20:63254483-63254505 CGGGGGCGGGGGCCGAGCGCGGG - Exonic
1176547138 21:8206897-8206919 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
1176555043 21:8251106-8251128 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
1176566089 21:8389944-8389966 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
1176573965 21:8434130-8434152 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
1176767712 21:13037339-13037361 CAGTGGCGGTGTCCGACCCTGGG - Intergenic
1179522476 21:41954039-41954061 CGGGGGCGGTGCCCGAGGGAGGG + Intergenic
1180199461 21:46215798-46215820 TGGGGGCAGTGTCTGAGCCTTGG + Intronic
1180432266 22:15263640-15263662 CAGTGGCGGTGTCCGACCCTGGG - Intergenic
1180908397 22:19431658-19431680 CGGCGGCGGCGGCCGAGCGCGGG - Exonic
1181083614 22:20429344-20429366 CGGGGGCGGGGTCTGAGCGGAGG + Exonic
1182552487 22:31107645-31107667 CTGGGGCGGAGACCGAGCGCTGG - Intronic
1184791216 22:46701297-46701319 CGCGGGTGGTTTCCGAGCCTCGG + Intronic
1185385644 22:50530311-50530333 GCGGGGCGGGGCCCGAGCGTCGG - Intronic
1203252013 22_KI270733v1_random:123182-123204 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
1203260067 22_KI270733v1_random:168265-168287 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
953373070 3:42406494-42406516 AGGGAGAGGTGGCCGAGCGTGGG + Intronic
953981952 3:47417698-47417720 CGGGGGCGGTGTCTCAGGGGAGG + Exonic
956414642 3:69013431-69013453 CGCGGGCGGAGTGCGTGCGTAGG + Intronic
966872305 3:184299069-184299091 CGAGGGCGGGGTCCGAGGGCGGG + Exonic
970636912 4:18020999-18021021 CGGGGGCGTCGTCCGAGGGGCGG - Intronic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
984811340 4:183798203-183798225 CGGGGGCCCTCTGCGAGCGTGGG + Intergenic
984973268 4:185209461-185209483 CGGGGGCGGGGTCCGGGCCGGGG - Intronic
985964070 5:3326421-3326443 CGGGGGTGGTGGCCGCACGTGGG - Intergenic
992080891 5:73233736-73233758 CGCGGGCGGGGTCCACGCGTGGG - Intergenic
993095496 5:83474103-83474125 CTGGGGCGGGGCCCTAGCGTTGG - Intronic
995106178 5:108380845-108380867 CGGGGACGCTGTCCGAGCCGGGG - Exonic
998236367 5:140401914-140401936 CGGCGGCGGTGACCGCGAGTGGG + Exonic
998295617 5:140966682-140966704 CGGAGGCGGGGCCCGGGCGTGGG + Exonic
999365489 5:151020892-151020914 CGGGGGCGGGGTCCCGGCGGCGG - Intronic
1000815702 5:165919395-165919417 CGGGGGCGGTGGCCGGGCGGAGG - Intergenic
1019325593 7:436764-436786 CGGGGGCCGTGCCTGAGAGTGGG + Intergenic
1021983670 7:26079117-26079139 CGCGGGCGGTGTGGGCGCGTCGG - Intergenic
1022106340 7:27200151-27200173 CGGGGCCGGGGCCCGAGCGAGGG + Intergenic
1029445778 7:100612286-100612308 TGGGGCCCGTGTCCGAGCTTAGG + Intronic
1031899453 7:127392888-127392910 CGAGGGCCGTGTCCGAGGGGAGG + Intronic
1034263586 7:149771651-149771673 CAGGGGCGGTGTCCGGGCCTTGG - Intronic
1040093284 8:43419501-43419523 CGGGGTGGCTGGCCGAGCGTGGG + Intergenic
1040981702 8:53251547-53251569 CGGGGCCGGGGTCCGAGAGCAGG - Exonic
1049090608 8:140511272-140511294 CGGGGGCGGTGTCCGAGCGTCGG + Intergenic
1051774640 9:20621187-20621209 CCGGGGCGGTTTCCCGGCGTGGG + Intronic
1056413477 9:86354568-86354590 GGGAGGCGGGGTCGGAGCGTGGG - Intergenic
1061681927 9:132246905-132246927 GGGGGGCGATGTCTGAGTGTGGG - Intergenic
1061987049 9:134136038-134136060 AGGGGGCGGTGTCCGGGGGGCGG - Intronic
1203468416 Un_GL000220v1:106332-106354 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
1203476237 Un_GL000220v1:150304-150326 CCGCCGCGGTGTCCGCGCGTGGG + Intergenic
1185464412 X:346264-346286 CGGGGGCGCTGTCAGTGCGGTGG + Intronic
1190732754 X:53235805-53235827 CGGGGGCGGCGTAACAGCGTGGG - Exonic
1193148018 X:78097433-78097455 CGGGAGCGGTGGCTGAGCGGTGG + Intronic
1199699112 X:150363484-150363506 CGGGGGCAGTGTCCGAGGGGCGG - Exonic