ID: 1049090885

View in Genome Browser
Species Human (GRCh38)
Location 8:140512367-140512389
Sequence GCTGGGGCCCCTCGTCTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049090880_1049090885 -10 Left 1049090880 8:140512354-140512376 CCCGCCCGCCACAGCTGGGGCCC 0: 1
1: 0
2: 3
3: 30
4: 342
Right 1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG No data
1049090876_1049090885 -6 Left 1049090876 8:140512350-140512372 CCCTCCCGCCCGCCACAGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 288
Right 1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG No data
1049090872_1049090885 22 Left 1049090872 8:140512322-140512344 CCAGCTCCAGCGGTCCGAGGCTT 0: 1
1: 0
2: 1
3: 6
4: 78
Right 1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG No data
1049090878_1049090885 -7 Left 1049090878 8:140512351-140512373 CCTCCCGCCCGCCACAGCTGGGG 0: 1
1: 0
2: 0
3: 33
4: 346
Right 1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG No data
1049090874_1049090885 8 Left 1049090874 8:140512336-140512358 CCGAGGCTTTCGAGCCCTCCCGC 0: 1
1: 0
2: 0
3: 8
4: 78
Right 1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG No data
1049090873_1049090885 16 Left 1049090873 8:140512328-140512350 CCAGCGGTCCGAGGCTTTCGAGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1049090885 8:140512367-140512389 GCTGGGGCCCCTCGTCTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049090885 Original CRISPR GCTGGGGCCCCTCGTCTAAG AGG Intronic
No off target data available for this crispr