ID: 1049091768

View in Genome Browser
Species Human (GRCh38)
Location 8:140520062-140520084
Sequence CACGCTTCTGCCTCGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049091760_1049091768 20 Left 1049091760 8:140520019-140520041 CCTCTGTTTGTGGAACAGGGCTC No data
Right 1049091768 8:140520062-140520084 CACGCTTCTGCCTCGGGAGCTGG No data
1049091763_1049091768 -10 Left 1049091763 8:140520049-140520071 CCATCCCTGAAGGCACGCTTCTG No data
Right 1049091768 8:140520062-140520084 CACGCTTCTGCCTCGGGAGCTGG No data
1049091759_1049091768 21 Left 1049091759 8:140520018-140520040 CCCTCTGTTTGTGGAACAGGGCT No data
Right 1049091768 8:140520062-140520084 CACGCTTCTGCCTCGGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049091768 Original CRISPR CACGCTTCTGCCTCGGGAGC TGG Intergenic
No off target data available for this crispr