ID: 1049095207

View in Genome Browser
Species Human (GRCh38)
Location 8:140544601-140544623
Sequence CAGAGGGAGTAGAGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 645
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 596}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049095207_1049095212 -4 Left 1049095207 8:140544601-140544623 CCTTCTACCCTCTACTCCCTCTG 0: 1
1: 0
2: 2
3: 46
4: 596
Right 1049095212 8:140544620-140544642 TCTGCAGCCACACCCACGCCAGG No data
1049095207_1049095213 -3 Left 1049095207 8:140544601-140544623 CCTTCTACCCTCTACTCCCTCTG 0: 1
1: 0
2: 2
3: 46
4: 596
Right 1049095213 8:140544621-140544643 CTGCAGCCACACCCACGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049095207 Original CRISPR CAGAGGGAGTAGAGGGTAGA AGG (reversed) Intronic
900168368 1:1254152-1254174 CAGACGCAGAAGAGGGGAGACGG + Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900467982 1:2835073-2835095 CAGAGGGAGTCGGGGGTCGGAGG + Intergenic
900964957 1:5951506-5951528 CAGATGGAGTAGGGAGAAGAGGG - Intronic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
901784527 1:11616097-11616119 CTGAGGGAGCAGAGGGCAGTGGG - Intergenic
901882824 1:12204108-12204130 CAGAAGGGGCAGAGGGGAGAGGG - Intronic
901930708 1:12595084-12595106 CAGAGGGAGGGGAGGGGAGGCGG + Intronic
902615876 1:17623287-17623309 CAGTGGGATTAGAGGGTGGCAGG + Intronic
902917356 1:19646641-19646663 CAGAGGGTGTGGAGGGTGGCTGG - Intronic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
904155294 1:28478053-28478075 CAGAGGCAGGGAAGGGTAGAGGG - Intronic
904973034 1:34433984-34434006 GAGACAGAGGAGAGGGTAGAGGG + Intergenic
906658312 1:47564770-47564792 CAGAGGAAGTAAAGGGGAGAAGG + Intergenic
907124387 1:52036497-52036519 CAGAGGCAGAAGAGGGTGGAAGG + Intronic
907255131 1:53173408-53173430 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
907494687 1:54836083-54836105 CAGAGGGGTTTGAGGGGAGAAGG - Intronic
908918864 1:69166253-69166275 CAGACAGAGTACAGGGTATAAGG + Intergenic
909025019 1:70471297-70471319 CAGAAGGAAGAGAGGGTAGGTGG - Intergenic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909749601 1:79142578-79142600 CAGAGAGGGTAAAGGGTACAAGG + Intergenic
909751080 1:79161875-79161897 CAGAGGGAATAGCAGGTAGAAGG + Intergenic
910566270 1:88646342-88646364 ATGAGGGAGCAGAGGGTACATGG + Intergenic
911482323 1:98459716-98459738 CATAGGCAGTTGAGGTTAGATGG + Intergenic
912496334 1:110094492-110094514 CAGAGGGGGTTGGGGGTAAATGG - Intergenic
912557428 1:110526294-110526316 CAGAGAGACTAGATGGGAGAAGG - Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
913237953 1:116801057-116801079 CAGAGGGAGCAGAGGTGAAATGG + Intergenic
913531521 1:119737302-119737324 CAGAGGGAGGAGAGGAAGGAAGG + Intronic
913534662 1:119759694-119759716 CAGAGGGAGGAGAGGAGAAATGG - Intronic
914370610 1:147021532-147021554 CAGAGGGAGGGGAGGATAGGGGG - Intergenic
914510574 1:148328977-148328999 CAGCGGGAGTAGAAGGGACACGG - Intergenic
915225144 1:154406132-154406154 CAGAGGGAGAAGAGGGGCGCTGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
916014114 1:160733293-160733315 CAGATGGAGGAGGAGGTAGAAGG + Intergenic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917296295 1:173522834-173522856 CAAAGGGAGTAGTGGGTGCAAGG - Intronic
917374364 1:174333163-174333185 GAGAATGAGGAGAGGGTAGATGG + Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
919157295 1:193782584-193782606 CAGAGGCTGGGGAGGGTAGAGGG + Intergenic
919282432 1:195508444-195508466 GGGAGGGAGTAGAAGGGAGAAGG - Intergenic
919794687 1:201314217-201314239 CCGAGGCAGGAGCGGGTAGAGGG + Intronic
919930230 1:202216624-202216646 GAGAGGTAGTAGAGAGCAGAGGG + Intronic
919986382 1:202678717-202678739 CAAAGTGAGTTGAAGGTAGAAGG - Intronic
921196599 1:212763174-212763196 CAAAGGGAGTGGAGAGTAGTGGG - Intronic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923027685 1:230219049-230219071 CAGATGGTGGAGAGGGGAGATGG - Intronic
923154874 1:231269354-231269376 CAGATGGGGTGGTGGGTAGATGG + Intronic
923679011 1:236104102-236104124 GAGAGGGAGCAGATGGGAGACGG - Intergenic
924057106 1:240134679-240134701 AAGAGGGAGAAGATGGGAGAAGG + Intronic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924577583 1:245294274-245294296 GAGAGGGAGGGGAGGGGAGAGGG - Intronic
924745914 1:246833606-246833628 CAGAGGGGGTAGTGGGGATATGG - Intergenic
924820110 1:247481207-247481229 GATAGGTAGTAGATGGTAGATGG - Intergenic
1063369842 10:5514072-5514094 CAGAGGGAGGAGAGGGGGCAGGG - Intergenic
1064573770 10:16723740-16723762 AAGATGGACTAGAGGGTGGAGGG + Intronic
1064660187 10:17600093-17600115 CAGAGAGAGAAGTAGGTAGAAGG - Intronic
1064808934 10:19170953-19170975 AAGAAGGAGTAGAGAGTAGTAGG - Intronic
1065326826 10:24556865-24556887 CAGAGGGAGCCGCGGGTAGGTGG - Intergenic
1065722754 10:28642447-28642469 CAGAGAGGGGAGAGGGGAGAAGG - Intergenic
1066047470 10:31605701-31605723 GAGAAGCAGCAGAGGGTAGAAGG - Intergenic
1067000334 10:42605395-42605417 CAGAGACAGTAGAGGCCAGAAGG + Intronic
1067224904 10:44369283-44369305 CAGAGGGAGCAGAGAGTGAATGG + Intergenic
1067561748 10:47309448-47309470 CAGAGGCAGTAGAGGGCAGGGGG + Intronic
1067977721 10:51044587-51044609 AGGAGGGAGTAGAGGGCAGGAGG + Intronic
1069678295 10:70265385-70265407 ATGAGAGAGTAGAGAGTAGATGG + Intronic
1069967731 10:72135331-72135353 GAGAGGGAGTAGAGTGTGAATGG + Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1072158851 10:92747943-92747965 CAGAGGGAGAAGAGGGGGAAGGG - Intergenic
1072428095 10:95347412-95347434 CAGATAGAGGAGAGGGTAGGAGG - Intronic
1073096311 10:100982210-100982232 CAGAGGGAGCAGCAGGCAGAGGG + Intronic
1073184752 10:101609130-101609152 CACAGCTAGAAGAGGGTAGAGGG + Intronic
1073894920 10:108144334-108144356 CAGAGGGAGGAGGGGGGGGAAGG - Intergenic
1074515340 10:114163232-114163254 CAGAGGAAGTAGAGGCTATGTGG + Exonic
1074856401 10:117477189-117477211 CAGAGTGAGGAGAGGCTAGGAGG + Intergenic
1074895989 10:117778176-117778198 CAGAGGGAGGAGCAGGTACAAGG + Intergenic
1074953573 10:118365039-118365061 CAGAGTGTGTATAGGGTACAAGG - Intergenic
1074964086 10:118473445-118473467 GAGAGGGAGCAGAGGGGAGGAGG - Intergenic
1075121175 10:119666096-119666118 CAGAGGGCCTGGAGGGTAAAGGG - Intronic
1075413738 10:122247747-122247769 CAGTGGGGGTAGAAGGGAGACGG + Intronic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075698708 10:124454447-124454469 CAGAGGGAGTGGGGGGGAGGGGG + Intergenic
1076135138 10:128040484-128040506 CAGGGCGAGTGGAGGGTGGATGG + Intronic
1076284680 10:129282000-129282022 CATAGGAGGGAGAGGGTAGAGGG - Intergenic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076856292 10:133116926-133116948 CAGAGGGCGGGGAGGGTAAAGGG + Intronic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1078141190 11:8694172-8694194 GAGAGGGAGTGGAGGTTGGAAGG - Intronic
1078151595 11:8764250-8764272 AAGAAGCAGTAGAGGGTAGAGGG + Intronic
1079117960 11:17652574-17652596 CAGAGGGAGCAGTGGAAAGAAGG + Intergenic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081401098 11:42643918-42643940 TAGAAGGATTATAGGGTAGAAGG + Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081976892 11:47241108-47241130 CAGATGGAGTAGGGCCTAGAAGG + Intronic
1082050726 11:47768338-47768360 CAGAGGCAGGAGACGGGAGAGGG - Intergenic
1082728118 11:56761371-56761393 CAGAAGGAGAAGAGAGTAGATGG - Intergenic
1082777624 11:57259656-57259678 CAAAGGGAGAAGTGGGAAGAGGG - Intergenic
1082799361 11:57402975-57402997 GAAAGGGAGTAGGGGGTGGATGG + Intronic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1084358518 11:68654540-68654562 CAGAGGGTGTAGTGGGAAGTGGG - Intergenic
1084785667 11:71440426-71440448 CAGACGGGGTGGAGGGTGGATGG + Intronic
1084937368 11:72594317-72594339 CAGAGGGTGCAGAAGGAAGATGG - Intronic
1086813157 11:91335710-91335732 CAGAGGGAGTGGAAAGTAGCAGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1089540014 11:119184128-119184150 CAGAGGCAGTGGAGGCTGGAAGG + Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089842662 11:121431797-121431819 CAGAAGGAGAAGAGGTTAAAAGG - Intergenic
1090254289 11:125272556-125272578 CAGAGGGAGAAGGGGAGAGAGGG - Intronic
1090620265 11:128554202-128554224 CAGAGGGAGTATAGGACAGTGGG + Intronic
1090974599 11:131670853-131670875 CAGAGGGAGCAGAGGGGAAGGGG - Intronic
1090982130 11:131732407-131732429 GAGAAGGGGTAGAGGGTGGAAGG - Intronic
1091312023 11:134581362-134581384 CTGAGGGAGTACATGGTACATGG + Intergenic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092943945 12:13436027-13436049 CAGAGGGAGTGGGGGGAAAAGGG - Intergenic
1092998247 12:13971481-13971503 CAGAGGAGGAAGAGGGTAGGAGG - Intronic
1093617655 12:21247527-21247549 TAGTGGGAGTAGGGGGTGGATGG + Intergenic
1095376693 12:41537757-41537779 CAGAGGGAGTAGAAAGTAAGGGG + Intronic
1095487699 12:42701900-42701922 AAGAGGGAGTTAAGGGTACAAGG + Intergenic
1095709791 12:45276052-45276074 CAGAGGCAGGATGGGGTAGATGG - Intronic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095861090 12:46918744-46918766 CAGAGGGAGGAAAGAGTAGCGGG + Intergenic
1096290697 12:50340359-50340381 TACAGGGATTAGAGGGTAGAAGG - Intronic
1096835317 12:54346892-54346914 GAAAGGGAGGAGAGGGTAAATGG - Intronic
1100524001 12:95403144-95403166 AAGAGGGACTAGAGGATAGTGGG - Intergenic
1100752701 12:97716716-97716738 CAAAGGGAGCAGAGGAGAGAAGG - Intergenic
1101662189 12:106775321-106775343 CAGAGTGTTTATAGGGTAGATGG + Intronic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1102175422 12:110870581-110870603 CAGATGGAGCAGAGGATGGAGGG - Intronic
1102444015 12:112987451-112987473 GAGAGCGAGTCCAGGGTAGAAGG - Intronic
1102547569 12:113667661-113667683 CAGAGAGAAAAGAGGGGAGATGG - Intergenic
1102591199 12:113958103-113958125 CAGAGGTAGCAAATGGTAGATGG + Intronic
1104653143 12:130552230-130552252 CAGCCAGAGTAGGGGGTAGAGGG + Intronic
1105649994 13:22366632-22366654 CAGAGGTGGGAGAGGGTAGGGGG + Intergenic
1106269277 13:28138467-28138489 GGGAGGGAGGAGGGGGTAGAAGG - Intergenic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106777181 13:33019767-33019789 GAGAAGGAGAAGAGGGGAGAGGG + Intronic
1107372261 13:39766090-39766112 CAGAGGCAGTACTGGGGAGAGGG - Intronic
1108213138 13:48158403-48158425 TAGAGAGAATTGAGGGTAGAAGG - Intergenic
1111669447 13:91311373-91311395 CAGAGGGAGCAGACGAAAGAAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111976879 13:94975526-94975548 GAGAAGGAGGAGAGGGTAAAAGG + Intergenic
1112193472 13:97201002-97201024 CAGAGGGAGAAGAGGGTCTGAGG - Intergenic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112823966 13:103370306-103370328 CAGTGGGAGATGAGGGTAGCTGG + Intergenic
1112893228 13:104264905-104264927 AAGAGGGAGTAGAGGCTAGAGGG - Intergenic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114208294 14:20593959-20593981 CAGAGTCAGTAGTGGGGAGAGGG - Intronic
1115973775 14:38974443-38974465 CATCGAGAGTAGAGGGTAGTGGG - Intergenic
1115979799 14:39037886-39037908 GAGAGGGAGTAAAGGCAAGATGG - Intronic
1116037745 14:39648388-39648410 CACAGAGAGTAAATGGTAGAGGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116334460 14:43639564-43639586 CACAGGGAGTGGAGAGTAGCAGG - Intergenic
1116746776 14:48830155-48830177 GAGAGGGGGGAGAGGGGAGAGGG + Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117063727 14:51988469-51988491 CAGAGGGACTAGAGCTTATAGGG - Intergenic
1117366958 14:55038621-55038643 CAGACACAGCAGAGGGTAGAGGG - Intronic
1118818454 14:69328930-69328952 CAAAGAGAGGAGAGGGTAGGAGG + Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118974554 14:70665449-70665471 GAGAGGGAGGAGAGGGGAGGGGG + Intronic
1120388359 14:83874009-83874031 CAGAAGGAGCAGACGGGAGAAGG + Intergenic
1121120553 14:91373194-91373216 CAGAGGGAGAAGAGAGAAGGTGG - Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121805971 14:96823116-96823138 GATAGGGAGTAGAAGGTAGAAGG - Intronic
1122148125 14:99706268-99706290 CAACGGGAGTAGAGGGCAGGAGG + Intronic
1122688284 14:103520315-103520337 CAGACGGAGAAGAGGGTATGAGG + Intronic
1123510417 15:20993024-20993046 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123567632 15:21566773-21566795 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123603891 15:22004066-22004088 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1124041546 15:26110198-26110220 AAGAAGGAGGAGAGGGTGGAGGG + Intergenic
1124639633 15:31389476-31389498 GAGAAGGTGCAGAGGGTAGAGGG - Intronic
1124693616 15:31845709-31845731 CAGAGTGGGTAGAGGGTACAGGG - Intronic
1125327386 15:38549680-38549702 CAAAGGGAGTAGAGACTAGAGGG - Intronic
1126114787 15:45198905-45198927 CAGTGGGAGTTTAGGGGAGACGG + Exonic
1126183593 15:45809794-45809816 CAGATGTAGCAGAAGGTAGAAGG + Intergenic
1126838350 15:52691057-52691079 CAGGGGGAGTGGAGAGTTGAGGG + Intronic
1126898440 15:53285986-53286008 CAGAGGAAGTAGAGACCAGAAGG + Intergenic
1127229393 15:56971898-56971920 TAGCGGGAGTAGATGGAAGAAGG + Intronic
1127404953 15:58633915-58633937 AAGAGGGGGTAGAGGAAAGAAGG + Intronic
1128107574 15:65055898-65055920 CAGAGGCAGGAGAGGGCAGGGGG + Intronic
1128174260 15:65540636-65540658 TAGAGGGAGATGAGGATAGAAGG + Intronic
1128338167 15:66801919-66801941 AAGAGGCAGCAGAGGGTTGAGGG + Intergenic
1129000019 15:72325026-72325048 GAGAGAGAGGAGAGGGGAGATGG - Intronic
1129166851 15:73783376-73783398 GAGATGGAGGAGAGGGCAGAGGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129634357 15:77298977-77298999 CACAGGGATTAGAGGGCAGAGGG - Intronic
1129648189 15:77457786-77457808 CAAAGGAAGTAGAGGATGGAAGG - Intronic
1130164121 15:81435449-81435471 CAGAGGGAGTCAAAGGGAGAAGG - Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130941264 15:88511230-88511252 TGGAGGGAATAGAGAGTAGAGGG - Intergenic
1130964334 15:88685941-88685963 CAGAGGCAGCAGAGTGGAGATGG + Intergenic
1131090893 15:89624375-89624397 CAGGGGGAGTTGAGGGAACAGGG - Exonic
1131839808 15:96425031-96425053 CAGAGGGTGGAAAGGGTAGTGGG + Intergenic
1131983387 15:98017408-98017430 CAGAGGGAGCAGGGGGAGGATGG - Intergenic
1132322063 15:100932834-100932856 CAGAGGGAGCAGCAGATAGATGG - Intronic
1202975995 15_KI270727v1_random:293868-293890 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1132984480 16:2757283-2757305 TAGAGGGAGTAGTAAGTAGAGGG + Intronic
1133023864 16:2979387-2979409 CTGAGGGAGTACAGGGGTGAGGG + Intronic
1133215800 16:4291737-4291759 CAGAGAGAGTGGAGGGTCAAAGG + Intergenic
1133392813 16:5422969-5422991 GAGAGGGAGGAGTGGGGAGAGGG + Intergenic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135694746 16:24575885-24575907 GAGAGGGAGGAGAGGGAGGAGGG + Intergenic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1136358233 16:29760704-29760726 TAGAGGGAGGAGAGGGAAAAGGG - Intergenic
1137547680 16:49415719-49415741 CAGAGGGAGGGGAGGCCAGAGGG + Intergenic
1138150973 16:54656725-54656747 CACAGTGAGTAGATGGAAGAAGG + Intergenic
1138315464 16:56065923-56065945 CACAGGGAGCAGAGGGATGAAGG - Intergenic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138768416 16:59632040-59632062 CAGAGGGAGAAGTGGGGAGAGGG + Intergenic
1139168550 16:64601588-64601610 GAGATGGAGTAGAGGGCAAAGGG + Intergenic
1139276707 16:65734576-65734598 CACAGGGAGTAGAGGACAGTAGG - Intergenic
1139365464 16:66429677-66429699 CAGAGGAAGAAGAGGAGAGAGGG - Intronic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139686177 16:68605425-68605447 CAGAGGAAGTAGAGTGTGGAAGG - Intergenic
1140644652 16:77016240-77016262 CAGAAGGTGCAGAGAGTAGATGG + Intergenic
1141382612 16:83589398-83589420 CAGCGGGAGTAGATGGGTGATGG - Intronic
1141619594 16:85229873-85229895 CAGGGTGAGAAGGGGGTAGAGGG + Intergenic
1141650140 16:85388441-85388463 CAGATGGATGAGTGGGTAGATGG + Intergenic
1141650168 16:85388549-85388571 CAGATGGATGAGTGGGTAGATGG + Intergenic
1141713995 16:85716552-85716574 CAGAGGGAGGGAAGGGGAGAGGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142313090 16:89325436-89325458 GAGAGAGAGGAGAGGGGAGAGGG - Intronic
1142470551 17:161125-161147 AAGAGGGAGGAGAGGGCAGGAGG - Intronic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1143037407 17:4007322-4007344 CAGAGGGAGTAGAGAAAACAGGG + Intronic
1143361865 17:6377533-6377555 GAGAGGGAGAAGAGGGCAGGGGG - Intergenic
1143574222 17:7780577-7780599 CAGAGGGATTTGTGGGGAGATGG + Intronic
1143622856 17:8090972-8090994 GGGAGGGAGGAGAGGGGAGAAGG + Intergenic
1143900388 17:10170137-10170159 AGGGGGGAGCAGAGGGTAGAAGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144746726 17:17620905-17620927 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1146536967 17:33661090-33661112 CAGAGGGAGTGGAAGGGAGTCGG - Intronic
1146907884 17:36629690-36629712 CAGAGGGACCAGAGGGCAGCTGG + Intergenic
1146967770 17:37047492-37047514 AACAGGGAGGAGAGGGGAGAGGG - Intronic
1147185889 17:38712926-38712948 AAGAAGGAGTAGAGGGTATGGGG - Intronic
1147235033 17:39050994-39051016 AAGAGGGAGTAGAGGCTGGATGG - Intergenic
1147359457 17:39921922-39921944 AAGATGGGGTAGAGTGTAGATGG - Intronic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148162040 17:45455781-45455803 CTGAGGGACTACAGGGGAGAAGG - Intronic
1148346015 17:46904153-46904175 CAGATGAATTAGTGGGTAGATGG + Intergenic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149275290 17:55027084-55027106 CACAGGGAGTAGGGAGTAGCAGG - Intronic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149457690 17:56801635-56801657 CAGCTGGGGTAGAGGGCAGATGG + Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150864590 17:68836297-68836319 CAGAGGTATGGGAGGGTAGAGGG + Intergenic
1150947615 17:69765406-69765428 GAGAGGGAGGGGAGGGAAGAAGG - Intergenic
1151059361 17:71073289-71073311 CAGAGAGAGTAGATGGTTTAGGG + Intergenic
1151138135 17:71967159-71967181 CAGAGGGAGCAGAGGAGAGTGGG + Intergenic
1151397262 17:73831747-73831769 CAGAGGCTGTAGAAGGCAGACGG - Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1151887787 17:76933323-76933345 GGAAGGGAGCAGAGGGTAGAGGG - Intronic
1152247366 17:79192076-79192098 AAGAGGGAGGAGACGGTAGGGGG - Intronic
1153804411 18:8699872-8699894 CAGAGGAAGTAGAGAGGTGAAGG - Intergenic
1154157991 18:11959024-11959046 GAGAGAGAGGAGAGGGGAGAGGG - Intergenic
1154428757 18:14292153-14292175 CAGTGGGAGTTGAGGGTGGGTGG + Intergenic
1155340852 18:24812688-24812710 CACAGAGAGAAGAGGGCAGAAGG - Intergenic
1155991890 18:32286745-32286767 AATAGGGAGGAGAGAGTAGAAGG - Intronic
1156237209 18:35217020-35217042 AAGAAGGAATAGAGGGTGGAAGG - Intergenic
1156432068 18:37085797-37085819 GAGAGGGAGGAGAGGGAAAAAGG - Intronic
1156825334 18:41424372-41424394 AAGAGGGAGTTGAGGCTAAAAGG - Intergenic
1157191470 18:45585766-45585788 CAGAGGGAGAAGGGGGCAGGTGG - Intronic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1157893212 18:51438635-51438657 CAGAGGCAGGAGAGGGCAGGAGG + Intergenic
1158219956 18:55140304-55140326 GAGAGAGAGGAGAGGGGAGAGGG + Intergenic
1158522867 18:58186231-58186253 CAGAGGGAGTGGGGGAGAGAAGG - Intronic
1159088978 18:63825017-63825039 CAGAAGGAAGAGAGGGTGGAGGG + Intergenic
1159355927 18:67337417-67337439 CAGAAGTGGTGGAGGGTAGAAGG + Intergenic
1160220940 18:76977345-76977367 CACAGTCAGTAGAGGCTAGAGGG - Intergenic
1160498824 18:79392331-79392353 CAGAGGGAGGAGAGGGGACCGGG + Intergenic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161636223 19:5390905-5390927 CAGAGTGAGTAATGGGGAGATGG - Intergenic
1163200727 19:15767107-15767129 CAAAGGGAGTGGAGAGTAGCAGG + Intergenic
1164425669 19:28139273-28139295 CAGACGGAATAAAAGGTAGATGG + Intergenic
1164441740 19:28284638-28284660 TAGAGGGAAAAGAGGGTGGAGGG + Intergenic
1164740542 19:30572451-30572473 GTTAGGGAGTGGAGGGTAGAGGG - Intronic
1164798512 19:31056400-31056422 GAAAGGGAGTAGGGGGTGGAGGG - Intergenic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1165787270 19:38469235-38469257 CAGAGGGAGCCGAGGGGAGGAGG - Intronic
1166391000 19:42408900-42408922 CAGAGTGAGCAGTGGGGAGAGGG + Intronic
1166994475 19:46713788-46713810 CTGGGGGAGGAGAGGGTAGGGGG - Intronic
1167349642 19:48966444-48966466 CAAAGGGAGCAGAGGCTTGAGGG - Intronic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167487914 19:49773939-49773961 CAGAGAGGGAACAGGGTAGATGG + Intronic
1167698185 19:51026985-51027007 CAGAGAGAGAAGAGTGGAGATGG - Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168110201 19:54188173-54188195 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1168490699 19:56806420-56806442 AAGGGGGAGGAGAGAGTAGAAGG + Intronic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
924974806 2:162767-162789 CAGAGGGAGCAGAGGGTCTGTGG - Intergenic
924993856 2:339747-339769 GGGAGGGAGTACAGGGGAGAGGG - Intergenic
925157525 2:1658832-1658854 CAGAGGGAGCCGCGGGGAGATGG - Intronic
925632454 2:5908793-5908815 CTCAGGGAGAAGAGGGTGGAGGG + Intergenic
925656968 2:6159521-6159543 CAGAGGGAGATGGGGGTAGGGGG - Intergenic
925932799 2:8723609-8723631 CTGAGGGAGGAGATAGTAGAGGG + Intergenic
926049818 2:9737601-9737623 TAGAGGGAGTAGGGGGTACTAGG - Intergenic
926088045 2:10032422-10032444 CACATGGCGTAGTGGGTAGAGGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926645993 2:15290075-15290097 GGGAGAGAGTAGAGGGGAGAGGG + Intronic
926836436 2:17028622-17028644 CTGAGGTAGTAAAGGGTAAATGG - Intergenic
926849361 2:17178087-17178109 CCTAGGGTGGAGAGGGTAGAAGG - Intergenic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927599725 2:24430397-24430419 GAGAGAGAGGAGAGGGGAGAAGG - Intergenic
927873716 2:26640485-26640507 CAGAGGGAGGAGCTGGGAGAAGG + Intronic
928351982 2:30566117-30566139 TAGATGAAGTAGGGGGTAGATGG + Intronic
928493914 2:31812552-31812574 CAGAAGGAGTAAAGAGGAGATGG + Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929600677 2:43202545-43202567 AAGAGGGAGAAATGGGTAGATGG - Intergenic
930093221 2:47546902-47546924 CAGAGGGAGTACAGCTGAGAAGG + Intronic
930752077 2:54944101-54944123 GAGAGAGGGTAGATGGTAGAGGG - Intronic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
931476206 2:62590237-62590259 CAGAGGGAGCTGAGGGGTGAAGG + Intergenic
931515419 2:63048242-63048264 GAGAGGGAGGAGAGTGGAGAGGG - Intergenic
932236558 2:70125234-70125256 CAGGGGTAGTGGAGGGCAGAGGG + Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932467236 2:71931690-71931712 TAGATGGAGTAGAGGCTCGAGGG + Intergenic
932702098 2:73999155-73999177 TAGAGCTGGTAGAGGGTAGAGGG - Intronic
932834448 2:75023185-75023207 CAGGGGGAGTAGAGGGAGCAAGG + Intergenic
932836262 2:75040759-75040781 AAGAGGGAGGAGAGCGTAGTAGG - Intergenic
933944755 2:87276289-87276311 CAGAGGACGGATAGGGTAGAGGG + Intergenic
934078430 2:88447776-88447798 CTGAAGCAGTAGAGGGTAGTTGG - Exonic
935362247 2:102256482-102256504 CAAGTGGAATAGAGGGTAGATGG - Intergenic
936335456 2:111585290-111585312 CAGAGGACGGATAGGGTAGAGGG - Intergenic
936879506 2:117232896-117232918 CACAGGGAGTGGAGAGTAGCAGG + Intergenic
937310284 2:120898109-120898131 TCGAGGGAGTAGGGGGTGGATGG - Intronic
938056973 2:128223119-128223141 CAGAGAGAATAGATGGTAAATGG + Intergenic
938086623 2:128406134-128406156 TGGAGGGAGTAGAGGGGAGGAGG + Intergenic
938555674 2:132421827-132421849 GAGAGAGAAGAGAGGGTAGAGGG + Intronic
938555676 2:132421834-132421856 AAGAGAGGGTAGAGGGTAGAGGG + Intronic
939086715 2:137728261-137728283 CAGAGAGAGTAGTGGGTGGAGGG - Intergenic
939142634 2:138373865-138373887 CAGAAGTAGAAGAGAGTAGAAGG - Intergenic
939737371 2:145865353-145865375 CAGAGAGAAAAGATGGTAGAGGG - Intergenic
940060435 2:149559556-149559578 CAAAGGGAGGGAAGGGTAGAAGG + Intergenic
940942961 2:159583769-159583791 AAGAGAGAGTACAGGGCAGACGG + Intronic
942017772 2:171833751-171833773 CAGAGGGAGAAGAAGATGGAGGG - Intronic
942487901 2:176458512-176458534 CAGAGGGACTTGAGGGTAAGTGG - Intergenic
943624972 2:190188093-190188115 GAGAGGGAGTGGTGGGTGGAAGG + Intronic
945807626 2:214509550-214509572 AAGTGGGAGTAGAGGGTAAGAGG + Intronic
946010513 2:216560188-216560210 CAGAGGGAGGAGAGGGGAGGGGG - Intronic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946924869 2:224616558-224616580 CAGAGGGAGTAGGGAGATGAGGG - Intergenic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947479028 2:230480610-230480632 CAGATGAGGTAGGGGGTAGACGG + Intronic
947648101 2:231759677-231759699 AAGAGGGAGTTGATGGAAGATGG - Intronic
947778789 2:232738433-232738455 GATAGGGAGTAAAGGGTGGAGGG - Intronic
947922666 2:233891692-233891714 CAGGGGAGGTAGAGGGCAGAAGG + Intergenic
947935777 2:234002211-234002233 CAGAGCGAGGAGTGGGCAGAGGG + Intronic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
949072292 2:242033029-242033051 GAGAGAGGGCAGAGGGTAGACGG + Intergenic
1169376285 20:5068986-5069008 CATAGGGGGTAGAGGGCAGCTGG + Intronic
1169388200 20:5168816-5168838 CAGAGGGAGCAGTGGGCAGGAGG - Intronic
1170006039 20:11670221-11670243 CAGAGGGAGTAGAAGGTGCTAGG - Intergenic
1170895709 20:20412035-20412057 CTGAGGGAGTAGCTGGGAGAGGG + Exonic
1171066208 20:22017972-22017994 CAGAGGGAGGAGAGGGGATATGG + Intergenic
1171496651 20:25561026-25561048 GAGAGGGAGAGGAGGGGAGAGGG - Intronic
1171989745 20:31686714-31686736 CGGAGGGAGTAAGGGGTAAATGG + Intronic
1172101815 20:32488425-32488447 CAGAGGGAGTACTTGGTAGATGG + Intronic
1172329096 20:34062249-34062271 CAGAGAAAGTAGAGAGTAAAAGG - Intronic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1174425600 20:50429909-50429931 GAGAAGCAGTAGAGGGTGGAAGG + Intergenic
1174968004 20:55241221-55241243 CAGAGATAGTAGAGGTTGGAAGG - Intergenic
1175239904 20:57539396-57539418 CACAGGGAGGAGAGAGGAGAAGG - Intergenic
1175442462 20:59001413-59001435 AAGAGGGAGTGGAGGGCAGGAGG + Intronic
1175480882 20:59309906-59309928 CAGAGGGACTTGAGGCTGGAAGG + Intronic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175891569 20:62318210-62318232 AAGAGGGAGGAGAGAGGAGAAGG + Intronic
1176513691 21:7767423-7767445 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1177540473 21:22486989-22487011 CAGAGGTTGGAAAGGGTAGAAGG - Intergenic
1178041639 21:28646366-28646388 CAGAGGGAGAAGAGGATATGAGG + Intergenic
1178457218 21:32766614-32766636 GAGAGGAAGTAGAGGGCAGCAGG - Intronic
1178647804 21:34397947-34397969 GGGAGGGAGGAGAGGGGAGAGGG - Intronic
1178730816 21:35101037-35101059 CAGAGAGGGAAGAGGGTTGAGGG - Intronic
1179174883 21:39001080-39001102 CTGAGGCAGTAGAGGGTGGGTGG - Intergenic
1179535475 21:42048730-42048752 CAGATGGAGTGGACGGTAGTAGG + Intergenic
1179572681 21:42287147-42287169 CAGAGGCAGGAGAGGGCAGAGGG + Intronic
1180078096 21:45473291-45473313 CAGAGGGAGCGGTGGGTAGGTGG + Intronic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182550874 22:31100170-31100192 GAGAGGGAGAAGGGGGCAGAGGG - Intronic
1183298226 22:37044466-37044488 GAGACGGGGTGGAGGGTAGAAGG + Intergenic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
949284375 3:2383730-2383752 GAGAGGGAGAAGAGAGAAGAGGG - Intronic
949284377 3:2383746-2383768 GAGAGGGAGAAGAGAGGAGAGGG - Intronic
949310446 3:2691397-2691419 AAGAGGAAGAGGAGGGTAGAGGG + Intronic
949463935 3:4324679-4324701 AAGAGGGAGTAGAGGAAATAAGG + Intronic
949589287 3:5476551-5476573 CAGAGGAATTATCGGGTAGAGGG - Intergenic
950153196 3:10704045-10704067 CAGAGGGAGTGAGGGGAAGATGG - Intronic
950175936 3:10874444-10874466 CAGAGGGGGTAAAGGAAAGAAGG - Intronic
951623161 3:24628948-24628970 GAGAGGAAGATGAGGGTAGAAGG - Intergenic
951681033 3:25294808-25294830 AAGAGGGAGTGGAGGGGGGAAGG + Intronic
951800282 3:26588216-26588238 CAGAGGGAGGAAAGGGCTGAGGG - Intergenic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954802324 3:53194369-53194391 CAGAGGCAGTGGAGGGTGGTGGG + Intergenic
954952547 3:54488275-54488297 CAGAGGGAAGCAAGGGTAGAAGG + Intronic
956493956 3:69804322-69804344 GAGAGGGAGTAAAGGGGAAAGGG - Intronic
956623223 3:71241467-71241489 AAGAAGGATTAGAGGGTGGAGGG - Intronic
956644785 3:71444891-71444913 CATGGGGACTGGAGGGTAGAGGG + Intronic
957922164 3:86759935-86759957 CAAAGGGAGTAGGGGATAGCAGG + Intergenic
957955312 3:87178680-87178702 CAGAGGGAGAAGAAGGTAGAAGG - Intergenic
958151530 3:89699615-89699637 CAAAAGGAGTAGAGAGTAGCAGG - Intergenic
958421809 3:93939013-93939035 AAGGGGGAATAGAGGGTGGAAGG - Intronic
958768128 3:98395395-98395417 CACAGGGAGTAAAGAGTAGCAGG - Intergenic
959755280 3:109890018-109890040 GATAGGGGGTGGAGGGTAGAAGG - Intergenic
960223709 3:115146829-115146851 CGCAGGGAGTAGAGAGAAGAAGG + Intronic
960870444 3:122244016-122244038 CAGAGGCTGGAGAGGGTAGTCGG + Intronic
961009586 3:123426848-123426870 CAGAGGGAGGAGAAGCTAGGAGG + Intronic
961365201 3:126395148-126395170 CAGATGGGGTGGATGGTAGATGG - Intronic
961849703 3:129803337-129803359 GAGAGTGAGGGGAGGGTAGAAGG + Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203510 3:133417585-133417607 AGGAGTGAGTAGAGGGGAGATGG - Intronic
962343947 3:134606416-134606438 GGGAGGGAGGAGAGGGTAGGAGG - Intronic
962426254 3:135271559-135271581 CAGAGGGAGTTGGGGGCAGAAGG + Intergenic
962840753 3:139230424-139230446 AAGAGGGATTGGAGGGTGGAAGG - Intronic
963305889 3:143652603-143652625 CAGAGGGAGATGAGGCTAGAAGG - Intronic
963804367 3:149708462-149708484 CAGTGGGGGTTGAGGGGAGATGG - Intronic
964148310 3:153493172-153493194 CAGAGGCTGTGAAGGGTAGAAGG + Intronic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
967673491 3:192268271-192268293 CAGATGGAGTAGATGCTTGAAGG - Intronic
967844926 3:194035737-194035759 CAGAGGGGGTAGAGAGTGTATGG + Intergenic
967880207 3:194296616-194296638 CAGGGGGAGGGGAGAGTAGAAGG + Intergenic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
968610002 4:1552589-1552611 CAGTGGGAGGTGAGGGGAGAGGG + Intergenic
968651405 4:1761589-1761611 CAGAGGGAAGTGACGGTAGATGG - Intergenic
969057894 4:4413574-4413596 CAGAGGGAGCAGCGGGCAGTGGG + Intronic
970589923 4:17550628-17550650 GAGAGGGAGGAGAGGAAAGAAGG + Intergenic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
974417350 4:61627077-61627099 CAGAGGCAATAAAGGGTAGAGGG - Intronic
974976084 4:68893646-68893668 CAGACCTAATAGAGGGTAGAGGG - Intergenic
975237252 4:72013732-72013754 CAGGAAGACTAGAGGGTAGAAGG + Intergenic
975857766 4:78642539-78642561 CAGATGGAGTAAAGTGGAGAAGG - Intergenic
977711033 4:100125834-100125856 CATAGGGAAGAGAGGGGAGAAGG + Intergenic
978092680 4:104737185-104737207 CAGAGGTAATAGACGGTAGATGG + Intergenic
979158696 4:117430212-117430234 CAGAGGGAGTACATGGAAGCTGG - Intergenic
979956810 4:126963620-126963642 CAGAGGGAGTGTGGGGTAGTAGG - Intergenic
980086514 4:128396264-128396286 CAGAGGTAGAAGATGGTAAAAGG - Intergenic
980838773 4:138231179-138231201 CAGAGAGATGAGAGGGTAGGAGG + Intronic
981032941 4:140144127-140144149 CAGGGGTAGAAGTGGGTAGAAGG - Intronic
981330287 4:143500316-143500338 AAGATTGAGTAGAGGGTAGGTGG - Intergenic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
983860358 4:172698429-172698451 GAGACTGAGTGGAGGGTAGATGG - Intronic
984287389 4:177749569-177749591 CAGAGGTGGGTGAGGGTAGAGGG - Intronic
984825069 4:183916855-183916877 GATAGGAAGTAGAGGGAAGAGGG - Intronic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
986490724 5:8286905-8286927 GAGAGGGAGGAGAGGGAGGAAGG - Intergenic
986695815 5:10353750-10353772 GAGAGGAAGGAGAGGGGAGAGGG - Exonic
988253028 5:28785094-28785116 CAGAGTCAGTAGAGGATAGAAGG + Intergenic
989566584 5:42907180-42907202 GAGAGAGAGAAGTGGGTAGAGGG - Intergenic
990368758 5:55095662-55095684 CAGGTTGAGTAGAGGGTAGAGGG - Intergenic
990434327 5:55772710-55772732 CAGAGGAAGTAGAGGGTACCAGG - Intronic
990796289 5:59544688-59544710 CACAGTGAGTAGTGGGGAGAAGG + Intronic
991080083 5:62589199-62589221 TAGAGGGAGTGCAGGGTTGAAGG - Intronic
991168756 5:63595052-63595074 CAGAGGGTGTTGTGGGGAGAAGG + Intergenic
992548919 5:77843631-77843653 CCTAAGGAGTAGTGGGTAGACGG + Intronic
992703986 5:79369408-79369430 GGGAGGGTGGAGAGGGTAGAAGG + Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
994215088 5:97128902-97128924 CAGTGGGAGTATAGGTTGGATGG - Intronic
995019239 5:107348021-107348043 AAGAGAGAGTAGAGAGGAGAAGG - Intergenic
995289560 5:110435605-110435627 CAGAGGTAGTGAAGGGTAGAGGG - Intronic
995749561 5:115440054-115440076 CAGAGGGAGAAGGGTGGAGAAGG - Intergenic
996247017 5:121276645-121276667 CAGAGGGTGAAAAGGATAGAGGG + Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996821978 5:127639608-127639630 AAGAGAGAGGAGAGGGAAGAAGG - Intergenic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998080935 5:139274342-139274364 CCTAGGGAGAAGAGGGAAGAGGG - Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998735571 5:145136096-145136118 CAGAGACTGGAGAGGGTAGAGGG - Intergenic
999721515 5:154402232-154402254 CAGAGGGAGAAAGGGGAAGAGGG - Intronic
1000024030 5:157343313-157343335 CACAGGAAGTAGAGAGTGGAAGG + Exonic
1001084188 5:168688413-168688435 GAGAGGGAGGAGAGGGATGAGGG - Intronic
1001682490 5:173569267-173569289 GGGAGGGGGTAGAGGGAAGAAGG + Intergenic
1001794705 5:174492412-174492434 CAGGGGGAGAAAAGGGTAAAGGG + Intergenic
1002434075 5:179220654-179220676 CAGAGGGCATAGAGCGTGGAGGG - Intronic
1005958821 6:30682546-30682568 GACAGGGGGTAGAGGGTGGAGGG + Intronic
1006008188 6:31019917-31019939 GAGAGGGAGTATGGGGTGGAGGG + Intronic
1006316131 6:33293038-33293060 CAGATGGAGTTGGGGGAAGATGG - Exonic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006729066 6:36222082-36222104 CAGAGAGGGGAGAGGGGAGAAGG + Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007373024 6:41439287-41439309 CCGAGGGAGTAGAGGGTGAGAGG - Intergenic
1008132325 6:47733103-47733125 CAGGGGGTGTAGAGGGAAAAAGG - Intergenic
1008493781 6:52112453-52112475 CAGAGGGAGTAGAGTGGGCATGG + Intergenic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1009294982 6:61935180-61935202 AAGAGGGAGTAGAGGGCATGAGG + Intronic
1010192605 6:73209417-73209439 TTCAGGGAGTAGAGGGTAGTGGG - Intergenic
1010194239 6:73223976-73223998 CTCAGGGAGGAGAGGGTAGCAGG - Intronic
1010621514 6:78082465-78082487 CAGAGGCAGGAAAGGGTAGAGGG + Intergenic
1010779039 6:79922254-79922276 GAGAGGGAGGTGAGGGGAGAGGG - Intronic
1011548053 6:88502132-88502154 CACACGGAGTGGTGGGTAGATGG + Intergenic
1013232689 6:108171376-108171398 AAGAGGGAGAAAAGGGGAGAGGG - Intronic
1014159519 6:118151952-118151974 CAGAGGAAGTAGAAAATAGAGGG - Intronic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014878707 6:126694651-126694673 GAGAGAGAGTGGAGGGGAGAGGG + Intergenic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1015894135 6:137999982-138000004 GAGAGGGAGTGTAGGGGAGAGGG + Intergenic
1016950257 6:149572903-149572925 GAGAGGCAGAGGAGGGTAGATGG - Intronic
1017081490 6:150673651-150673673 GAGAGGGAGGGGAGGGAAGAGGG - Intronic
1018814856 6:167322976-167322998 CAGGCTCAGTAGAGGGTAGAAGG + Intergenic
1019324487 7:431629-431651 CACAGGGAGCAGAGGGTCGGAGG - Intergenic
1019445973 7:1071552-1071574 GAGAGGGAGGAAAGGGGAGAGGG + Intronic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1021936094 7:25632835-25632857 CAGAGTGAGTAGAGGATTAATGG + Intergenic
1022049092 7:26647742-26647764 CAGAGGCAGGTGAGGGGAGATGG - Intergenic
1022624919 7:32025366-32025388 GAGTGGGAGTTGAGGGTAGGGGG + Intronic
1022658822 7:32347113-32347135 TATAGGGAGTAGAGGTGAGACGG - Intergenic
1023326348 7:39062474-39062496 CATAGAAAGTAGAGAGTAGAAGG + Intronic
1023965401 7:44961251-44961273 CTGAGGGAGCTGAGGGTTGAGGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024416255 7:49110611-49110633 CAGAAGGTGGAGAGGGTATAGGG + Intergenic
1024604144 7:51011041-51011063 CTGATGGAGCAGAGGGCAGACGG - Intergenic
1026287692 7:68977665-68977687 CTGGGGGAGAAGAGGGCAGAAGG + Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1028424982 7:90676453-90676475 GTGAGGGAGGAGAGGGTAGTAGG + Intronic
1028905753 7:96152327-96152349 CCTAGGGAGCAGAGGGGAGAGGG + Intronic
1029316951 7:99724155-99724177 AAGAGGGAGTGGAGGCTGGAAGG - Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1031272050 7:119663896-119663918 GAGGGGAAGTAGAGGGTTGAGGG + Intergenic
1032158647 7:129492363-129492385 CAGAGGGAGTTGAGGGAGAAGGG - Intergenic
1032304617 7:130720902-130720924 AAGAGGGTGTAGAGGGTGAAGGG - Intergenic
1032464124 7:132133238-132133260 CATACGGAGTAGAGGAGAGATGG + Intronic
1032684903 7:134223420-134223442 CAGAGGCAGCAGGGGGTAGGTGG + Intronic
1032961682 7:137042489-137042511 GAGAGAGAGAAGAGGGAAGAGGG - Intergenic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1033365790 7:140672037-140672059 CGGAGGGAGCAGAGGGTCGGTGG - Intronic
1033796710 7:144853906-144853928 CAGAGTGAGTAGTGTGTGGAAGG - Intergenic
1034408984 7:150927854-150927876 AAGAGGGAGGACTGGGTAGAGGG - Intergenic
1034422112 7:150995759-150995781 CAGAGGGAGGAGGGGGTGCAGGG - Intronic
1034461042 7:151198235-151198257 CAGATGGAGAGGTGGGTAGAAGG + Intronic
1034956323 7:155337610-155337632 CTGAGGGGGTAGAGCATAGAGGG + Intergenic
1036403723 8:8434311-8434333 CAGAGGGTGCAGAGGAGAGAAGG + Intergenic
1037695013 8:21215963-21215985 CAGAGGGAGGAGATAGGAGATGG - Intergenic
1038235286 8:25746862-25746884 TAGATGGAGGAGAGGGGAGAGGG - Intergenic
1038437332 8:27545336-27545358 AGGAGGCAGGAGAGGGTAGAGGG - Exonic
1039466636 8:37789307-37789329 TGGAGGGAGTACAGGGGAGAAGG - Intronic
1040983556 8:53269523-53269545 CTCAGGGAGGAGAGGGTGGAAGG + Intergenic
1041746835 8:61216387-61216409 CAGACAGACTAGAGGGTGGATGG - Intronic
1042699648 8:71598243-71598265 CAGGTGGGGTTGAGGGTAGAGGG + Intergenic
1042710854 8:71715603-71715625 CAGAAGGAGTAGAGACTGGAAGG - Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044014158 8:87030837-87030859 GAGAGGGAGGAGAGGGGAGGGGG - Intronic
1044472777 8:92590032-92590054 CAGAGGGAGGGGAGGGTGTATGG - Intergenic
1044779847 8:95733078-95733100 CAGAGGGAGAAGAAGAGAGATGG + Intergenic
1044923411 8:97188839-97188861 CAGAGGGCACAGTGGGTAGAGGG - Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045238513 8:100377397-100377419 CAGAGGGAGTAGTAGAGAGAAGG + Intronic
1045420264 8:102007733-102007755 CAGAGGGAGGAGGAAGTAGAAGG - Intronic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1046115661 8:109780260-109780282 CAGAGGAAGAAGAGGTGAGAAGG - Intergenic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1048223563 8:132564669-132564691 CACATGGAGTAGAGGGTGGAGGG + Intergenic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1048681477 8:136846243-136846265 CCTTGGGAGTAGAGGGGAGAGGG + Intergenic
1049095207 8:140544601-140544623 CAGAGGGAGTAGAGGGTAGAAGG - Intronic
1049415251 8:142492072-142492094 CAGACAGAGGAGAGGGTGGATGG - Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050010521 9:1181490-1181512 CAGAGTGGGTAGAGCGGAGATGG - Intergenic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050842058 9:10162538-10162560 CAGAAAGGGTAGAGAGTAGAAGG + Intronic
1052583979 9:30400552-30400574 CAGAAGGAGCAGAGAGAAGAGGG - Intergenic
1052782896 9:32798858-32798880 CAGAGGTTGAAAAGGGTAGAGGG + Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055070136 9:72157586-72157608 CAGAGACACTAAAGGGTAGATGG - Intronic
1055390260 9:75813630-75813652 AAGTGGGAGTAGAGAATAGAGGG + Intergenic
1055884430 9:81043820-81043842 CAAAGGGAGTAAAGGAAAGATGG + Intergenic
1056408803 9:86303979-86304001 CAGAGGGAATAGGGGGTTGCTGG + Intronic
1057887431 9:98840490-98840512 CAGAGGCAATAGTGGGTATAGGG + Intronic
1057914955 9:99048227-99048249 CAGAGGGAGTAGGGGAGAAAGGG + Intronic
1059176218 9:112172274-112172296 CAGAGCTAGTAGAGGAGAGAGGG - Intronic
1059205213 9:112458081-112458103 CAGTGGCACTAGAAGGTAGATGG - Intronic
1059764664 9:117372292-117372314 CAGAGGGTGAAGAAGGAAGAAGG + Intronic
1060077111 9:120601764-120601786 CCTAGGGGATAGAGGGTAGAGGG + Exonic
1060920128 9:127414553-127414575 AAGGGGGAATAGAGGGTGGAAGG - Intergenic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061466039 9:130780589-130780611 GAGAGGGAGATGAGGGAAGAGGG - Intronic
1061546945 9:131309839-131309861 CAGAGGGAGGAAAGGGGTGAGGG + Intergenic
1062707553 9:137953794-137953816 CAGAGGGTGTTGTGGGGAGAGGG + Intronic
1185537298 X:872774-872796 GAGAGGGAGGGGAGGGGAGAGGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688341 X:1948485-1948507 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688619 X:2134007-2134029 GAGGGGGAGGAGAGGGTAGAAGG + Intergenic
1185966824 X:4614916-4614938 CAGAGAGAGGAGGGGGGAGAGGG + Intergenic
1186130464 X:6460116-6460138 GTGGGGGGGTAGAGGGTAGATGG + Intergenic
1186238152 X:7535897-7535919 CAGAGGATGGAGAGAGTAGAGGG - Intergenic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1186875873 X:13817209-13817231 CAGTGGGAGTTGGGGGTAGGGGG + Exonic
1187035025 X:15529317-15529339 AAGAGGGGGGTGAGGGTAGAAGG - Intronic
1187207863 X:17199895-17199917 AAGATGGAGAAGAGGGCAGAAGG + Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187832541 X:23397577-23397599 CTGAGGGAGTAAAAGGCAGAAGG - Exonic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1189384874 X:40529086-40529108 CAGAGGCTGGAAAGGGTAGAGGG + Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190521773 X:51286431-51286453 GAGAGGGAGTAATGAGTAGATGG - Intergenic
1192914286 X:75636737-75636759 AAGAGGGAATTGAGGGTAGAAGG + Intergenic
1193571531 X:83151027-83151049 CAGAAAGAGTAGGGGGTATAGGG - Intergenic
1194241568 X:91456324-91456346 CACAGGGAGCAGAGAGTAGCAGG - Intergenic
1194901715 X:99520238-99520260 CATAGGCAGCAGAGGGTAGCAGG - Intergenic
1195017104 X:100790900-100790922 AAGAGGGAATGGAGGGTGGAAGG + Intergenic
1195749561 X:108150413-108150435 TAGAGGCAGTAGAGTGTAGTGGG + Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1196239874 X:113330915-113330937 CAGAGGGTGGAGAGGGGAGGAGG - Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1196883187 X:120218995-120219017 CAGAGGCTGTGAAGGGTAGAGGG + Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1198910145 X:141604586-141604608 TAGAGGGACTGGAGTGTAGAGGG + Intronic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1201146605 Y:11068095-11068117 GAGAGGGAGAAGAAGGAAGAGGG + Intergenic
1201461734 Y:14233013-14233035 GAGAGGGAGGAGGGGGGAGAAGG - Intergenic
1202088997 Y:21169502-21169524 CAGAGGTTGTAAAGTGTAGAGGG + Intergenic