ID: 1049097542

View in Genome Browser
Species Human (GRCh38)
Location 8:140557862-140557884
Sequence CAGAAGGACGAGAGGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 321}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049097542_1049097545 -8 Left 1049097542 8:140557862-140557884 CCACAGGCCCTCTCGTCCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 321
Right 1049097545 8:140557877-140557899 TCCTTCTGCTCCCTCAGCCACGG No data
1049097542_1049097553 24 Left 1049097542 8:140557862-140557884 CCACAGGCCCTCTCGTCCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 321
Right 1049097553 8:140557909-140557931 TACCTCCAGTGCCTGGCAACAGG No data
1049097542_1049097552 17 Left 1049097542 8:140557862-140557884 CCACAGGCCCTCTCGTCCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 321
Right 1049097552 8:140557902-140557924 ATCTTGGTACCTCCAGTGCCTGG No data
1049097542_1049097547 -7 Left 1049097542 8:140557862-140557884 CCACAGGCCCTCTCGTCCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 321
Right 1049097547 8:140557878-140557900 CCTTCTGCTCCCTCAGCCACGGG No data
1049097542_1049097556 29 Left 1049097542 8:140557862-140557884 CCACAGGCCCTCTCGTCCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 321
Right 1049097556 8:140557914-140557936 CCAGTGCCTGGCAACAGGCCTGG No data
1049097542_1049097548 1 Left 1049097542 8:140557862-140557884 CCACAGGCCCTCTCGTCCTTCTG 0: 1
1: 0
2: 1
3: 18
4: 321
Right 1049097548 8:140557886-140557908 TCCCTCAGCCACGGGCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049097542 Original CRISPR CAGAAGGACGAGAGGGCCTG TGG (reversed) Intronic
900361800 1:2292739-2292761 GGGGAGGACGTGAGGGCCTGTGG + Intronic
900557206 1:3286622-3286644 CATAAGGGCCTGAGGGCCTGGGG + Intronic
900690847 1:3979424-3979446 CAGAGCACCGAGAGGGCCTGGGG - Intergenic
900914707 1:5628354-5628376 CAGAAAAATGAGTGGGCCTGGGG + Intergenic
901005524 1:6169979-6170001 GCGGAGGACGAGAGGTCCTGGGG + Intronic
901493123 1:9606692-9606714 CAGAGGGAAGAGAGGGACAGAGG - Intronic
904233479 1:29097182-29097204 CAGATGGACAAGAAGGCCTTTGG + Intronic
904459264 1:30665926-30665948 CAGAAGGGAAAGAGGGTCTGGGG - Intergenic
908727531 1:67192909-67192931 CAGAAGGGTGACATGGCCTGAGG - Intronic
909025019 1:70471297-70471319 CAGAAGGAAGAGAGGGTAGGTGG - Intergenic
910653854 1:89600120-89600142 CAGAAAGACAAGTGGGCCTAGGG + Intergenic
911761598 1:101623426-101623448 CAGAAGGACAATAGAGCATGTGG - Intergenic
912259876 1:108099786-108099808 CAGAGGCACAAGATGGCCTGCGG + Intergenic
912527658 1:110296324-110296346 AAAAAGGAGGAGAGGGGCTGGGG - Intergenic
912726560 1:112063926-112063948 CAGAAGGAGGGGAGGGCCAAGGG - Intergenic
912930828 1:113959277-113959299 CAGAAGGAAAAGAGGGGCTAGGG + Intronic
914256504 1:145964369-145964391 CCAAAGGAGGAGAGGGCCTACGG - Exonic
914317571 1:146528605-146528627 CAGAAGGACAAGAGCTCTTGAGG - Intergenic
914496784 1:148204755-148204777 CAGAAGGACAAGAGCTCTTGAGG + Intergenic
915494015 1:156268222-156268244 CAGTAGGACCATAGGGACTGCGG - Intronic
915694009 1:157721087-157721109 CAGAAGGAAGAGAGAGACAGGGG + Intergenic
916421883 1:164645347-164645369 CAGAAGGACCAGAGAGCAAGGGG - Intronic
918761899 1:188420713-188420735 AGGAAGGAAGAGAGGGACTGAGG - Intergenic
921558909 1:216633253-216633275 CAGAAGAATCGGAGGGCCTGCGG + Intronic
921850354 1:219927707-219927729 CAGAAGAAAAAGAGGGCGTGGGG + Intronic
922184307 1:223260476-223260498 CAGATGGAGGTGAGGGCCTCAGG + Intronic
922349153 1:224721779-224721801 CTGAATGAAGAGGGGGCCTGTGG + Intronic
922591964 1:226784203-226784225 GAGAAGGACGTGAGAGGCTGTGG - Intergenic
922729651 1:227942943-227942965 GAGAAGGAGGGGTGGGCCTGAGG - Intronic
923064772 1:230507770-230507792 CAGAGGGATGTGAGAGCCTGTGG + Intergenic
923524582 1:234762628-234762650 CACAGGGAGGACAGGGCCTGAGG - Intergenic
923525494 1:234769444-234769466 CAGAAGGGCCAGCTGGCCTGGGG - Intergenic
924423795 1:243932710-243932732 CAAAAGGACCTGAGGTCCTGTGG - Intergenic
1063105437 10:2987928-2987950 CACATGGACTAGATGGCCTGCGG - Intergenic
1063218934 10:3948604-3948626 GAAAAGGACTAGAGGCCCTGGGG - Intergenic
1064027405 10:11859913-11859935 CAAAAGAAAGAGATGGCCTGGGG - Intronic
1065122679 10:22544226-22544248 CAGAATGACCTGTGGGCCTGGGG + Intronic
1065894927 10:30154815-30154837 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1066460627 10:35609072-35609094 CAGAAGGGCGAGCTGGCCTGGGG + Intergenic
1068389169 10:56370958-56370980 CAGAAGGACTAGAGAGACTACGG - Intergenic
1070573931 10:77662653-77662675 CAGAATGACCACACGGCCTGCGG + Intergenic
1070726575 10:78795693-78795715 GAGAAGGAAGAGAGGGATTGGGG - Intergenic
1070767113 10:79063161-79063183 CAGAAGGAGGAGAGATGCTGAGG + Intergenic
1071491027 10:86136440-86136462 CAGATGGAAGAGAGGGGCTCTGG + Intronic
1071602072 10:86963171-86963193 CAGAAGGACCAGAGGGTGGGTGG - Exonic
1072762139 10:98065465-98065487 GAGAAGGCCCAGAGGACCTGGGG - Intergenic
1073025193 10:100482560-100482582 CCGAAGGCCGAGAGTGCCTAAGG + Exonic
1074454562 10:113586081-113586103 CAGATGCACCAGAGGGCCAGGGG - Intronic
1074857400 10:117483574-117483596 CAGAGGGACAGGAGGGCCTGAGG + Intergenic
1075083605 10:119399802-119399824 CAGAAGGAGGTGTGGGCGTGAGG - Intronic
1075085628 10:119412610-119412632 CAGACGGACGTGAGGGTGTGTGG + Intronic
1075526349 10:123190440-123190462 CACAAGGACAGGAGAGCCTGGGG - Intergenic
1077220361 11:1413012-1413034 AAGAAGGAGGCCAGGGCCTGGGG - Intronic
1078216220 11:9314305-9314327 CAGAAGGGTGAGTGGGCCCGGGG - Exonic
1078462147 11:11522187-11522209 CAGAATGAGGAGAGGTCATGTGG - Intronic
1079129413 11:17738611-17738633 CAGTGGGAGGAGAGGGCCAGGGG - Intronic
1083025204 11:59544980-59545002 CAGAAAGACGACAAGGGCTGGGG + Intergenic
1083617560 11:64034202-64034224 CAGATGGACGTGTGGCCCTGGGG - Intronic
1084126449 11:67102241-67102263 CAGAAGAACCAGCTGGCCTGAGG - Intergenic
1084285716 11:68129084-68129106 CTGAAGGAGGAGGGGGCCTCAGG - Intergenic
1084981217 11:72829801-72829823 CAGCAGGAAGAAAGGCCCTGAGG + Intronic
1085392360 11:76188976-76188998 CAGAAGGAGGGGAGCGCCTGGGG + Intronic
1087093870 11:94302038-94302060 CAGAAGGGCGGGAGGGGGTGAGG + Intergenic
1087723168 11:101689736-101689758 CAGAAGGATGAGAGGGTGCGAGG + Intronic
1087850020 11:103017411-103017433 CAGAAGGAAGAGAAGGTTTGAGG + Intergenic
1088152439 11:106760863-106760885 CAGAAGGAAGACAGGAACTGAGG + Intronic
1089198249 11:116707831-116707853 CAGAGAGACGAGGTGGCCTGAGG + Intergenic
1089757076 11:120695116-120695138 CAGCAGGAGGAGAGGGCTGGGGG - Intronic
1089780414 11:120869736-120869758 CTGGAGGAAGAGGGGGCCTGGGG + Intronic
1091838433 12:3602271-3602293 CAGAATGAGGTGAGGGCATGGGG - Intergenic
1091840627 12:3617892-3617914 CAGAGGGTCGAGCTGGCCTGTGG - Intronic
1092231959 12:6780926-6780948 CAGAAGGAAGAAAGGGCATATGG + Intergenic
1093059608 12:14589212-14589234 CAAAAGGACTTGAAGGCCTGTGG - Intergenic
1098599177 12:72309446-72309468 CAGAGAGATGAGAGGGGCTGGGG + Intronic
1099084394 12:78227013-78227035 CAGAATGATGAGAGGCTCTGGGG + Intergenic
1099156546 12:79183637-79183659 AAGAGGGAGGAGAGGGGCTGTGG - Intronic
1099847367 12:88044781-88044803 CAGGAAGAGGAGAGGGCATGGGG + Intronic
1099868986 12:88322342-88322364 CAGGAGGAAGAGAGAGCATGGGG + Intergenic
1100403190 12:94250091-94250113 CAGAGGGAGCAGAGGTCCTGAGG + Intronic
1101212090 12:102544698-102544720 CAAAAGGAAGAGATGCCCTGTGG + Intergenic
1103947194 12:124533055-124533077 GAGAAGGAGGAGTGGGACTGGGG - Intronic
1104955869 12:132465549-132465571 CAGGTGGCCGAGAGGCCCTGGGG - Intergenic
1104970157 12:132527430-132527452 CAGGAGGACGACAGCCCCTGGGG + Intronic
1106033325 13:26021978-26022000 CAGGATGCAGAGAGGGCCTGAGG + Exonic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1112193472 13:97201002-97201024 CAGAGGGAGAAGAGGGTCTGAGG - Intergenic
1113453894 13:110433431-110433453 CAGGAGGCAGAGAGGGACTGTGG + Intronic
1114246894 14:20922546-20922568 CACAAGGTGGAGAGGGCATGGGG - Intergenic
1114631768 14:24163875-24163897 CAGGAGGAGGAGGGGGCCAGTGG + Exonic
1118064919 14:62180327-62180349 CAGAAGGACAAGAAAGTCTGTGG - Intergenic
1119099722 14:71868768-71868790 CAGTAGGACGAGAGGCCAAGGGG - Intergenic
1120849519 14:89156903-89156925 AAAAAGGAGGAGAGGGGCTGGGG + Exonic
1122143947 14:99677780-99677802 GAGAAGTACTGGAGGGCCTGAGG - Exonic
1123037664 14:105478061-105478083 CAGAGGGAGAACAGGGCCTGGGG + Intronic
1123696308 15:22881462-22881484 CAGATGGATGGGACGGCCTGGGG + Intronic
1124587637 15:31024390-31024412 CAGAAAGAGGAGAAGGCTTGAGG - Intronic
1125677038 15:41507623-41507645 CATCAGAACCAGAGGGCCTGGGG + Exonic
1126800214 15:52291436-52291458 CAGAAAGGAGTGAGGGCCTGAGG - Intronic
1126859801 15:52872721-52872743 AGGAAGGAAGAGAGGTCCTGCGG - Intergenic
1128091861 15:64924531-64924553 CAGAAGCAGGACTGGGCCTGTGG - Intronic
1128232844 15:66047719-66047741 CAGGAGGCCCAGTGGGCCTGGGG + Intronic
1129113577 15:73352518-73352540 CAGAAGAAACAGGGGGCCTGGGG + Intronic
1129698117 15:77752196-77752218 TGGAAGGATGAGAGGGGCTGGGG - Intronic
1130174167 15:81550233-81550255 CAGCAGCAGGAGGGGGCCTGTGG + Intergenic
1130235169 15:82126639-82126661 CAGAAGGCCCAGAGGACCTGTGG + Intergenic
1130765964 15:86871530-86871552 TAGAAGGAGGAGAGAGCCTGAGG - Intronic
1133889862 16:9868698-9868720 CAGAGGGAAGGGAAGGCCTGGGG - Intronic
1139653345 16:68373552-68373574 CAGGAGGAGGAGAGGGTGTGGGG - Intronic
1140263751 16:73402851-73402873 CAGAGGGAGGGGAGGGCTTGGGG + Intergenic
1141834740 16:86531389-86531411 CAGAGGGAGGAGCGGGGCTGGGG + Exonic
1142138365 16:88461693-88461715 CTGAAGGAGGGGAGGGCCAGCGG - Intronic
1142500083 17:327426-327448 CAGAAGGAAGGGACGGCCTGGGG + Intronic
1142708091 17:1709093-1709115 CAAAATGAAGAGAGGGCCGGGGG + Intronic
1142747501 17:1967153-1967175 CAGAAGGAAGAGGGGGCCCTGGG + Intronic
1142893333 17:2959163-2959185 GAGAAGGAAGAGAGGATCTGAGG - Intronic
1143337926 17:6187418-6187440 CTGCAGGAGGAGAGGCCCTGTGG - Intergenic
1143706206 17:8699141-8699163 CAGGAGGGAGATAGGGCCTGGGG + Intergenic
1144129936 17:12236874-12236896 AAAAAGGAGGAGAGGGGCTGGGG + Intergenic
1144825421 17:18103101-18103123 CAGCAGGAGGAGAGGACCTGAGG - Intronic
1146517303 17:33499175-33499197 CAGCTGGACCAGAGGGACTGAGG - Intronic
1146935199 17:36808698-36808720 CGGGAGGGCGAGAGGGGCTGCGG - Intergenic
1147793473 17:43027160-43027182 CTGAAGGAAGACAGGGCATGAGG - Intronic
1148673604 17:49431925-49431947 CAGGAGCTCCAGAGGGCCTGTGG + Intronic
1150485121 17:65537876-65537898 CAGAAGGGCCAGAGGCCCTGGGG + Intronic
1150558612 17:66275995-66276017 CAGGAGGACGGGTGGGACTGGGG - Intergenic
1151725108 17:75878876-75878898 CAGAAGGACCAGAGGGATGGAGG - Intergenic
1151802382 17:76385724-76385746 CAGCTGGACGAAAGGGGCTGTGG + Intronic
1152366740 17:79860745-79860767 GAGAAGGAAGAGAGGGACAGAGG - Intergenic
1152594109 17:81229897-81229919 CAGAGCGACGAGTGAGCCTGGGG - Intronic
1152641402 17:81450767-81450789 CACAAGGAATCGAGGGCCTGGGG + Intronic
1152742677 17:82025197-82025219 CAGAGGGATGAGGGAGCCTGAGG - Intronic
1152813563 17:82393819-82393841 CAGAAACACCAGAGGGCCAGAGG - Intronic
1154025237 18:10701339-10701361 CAGAAGGACAGGAGTCCCTGAGG + Intronic
1155071774 18:22323149-22323171 CAGGAGGAGGAGAGGGCTGGGGG + Intergenic
1155226278 18:23732238-23732260 CAGAGGGAAGAGAGGAGCTGAGG + Intronic
1157370703 18:47108984-47109006 GTGAATGACCAGAGGGCCTGGGG - Intronic
1157779366 18:50423803-50423825 CAGAAGGTAAAGAGGGACTGGGG - Intergenic
1159002435 18:62986398-62986420 CTGAAGGACGATGGGGCGTGGGG + Intergenic
1160141299 18:76325553-76325575 CAGAAGGTGGAGAAGGCTTGTGG + Intergenic
1160686972 19:441461-441483 CTGAGGGACGAGAGGGGCAGAGG + Intronic
1161785015 19:6319213-6319235 CAGAAGGAGGACAGAGACTGTGG + Intronic
1162750298 19:12825612-12825634 CAGAAGGCCGAGAGGACGAGGGG + Exonic
1163772263 19:19198249-19198271 CAGGAGGCTGAGAGGTCCTGGGG - Intronic
1164446152 19:28319113-28319135 CAGAAGGTAGGGAGGGCATGGGG + Intergenic
1165334804 19:35162245-35162267 GAGGAGGAAGAGAGGCCCTGGGG - Intronic
1167024228 19:46903210-46903232 CAGAATGAAGAGAGGGTTTGGGG - Intergenic
1167553648 19:50178706-50178728 AAGAGGGACAAGAGGGCTTGGGG + Intergenic
1167595847 19:50427806-50427828 CAGAACGCGGAGGGGGCCTGGGG + Intronic
1167726835 19:51220496-51220518 CAGAAGGAGGCGAGGCCATGTGG - Intergenic
1168332510 19:55578618-55578640 AAGAAGGACGACAAGGCCTCGGG - Exonic
1168598290 19:57696556-57696578 CAGAGGGAGCAGAGGGCCTGGGG + Intronic
1168651537 19:58095559-58095581 GAGCAGGAGGAGAGGGGCTGGGG - Intronic
924974806 2:162767-162789 CAGAGGGAGCAGAGGGTCTGTGG - Intergenic
925780940 2:7381199-7381221 CAGAAGTAAGAGAGGTCTTGGGG + Intergenic
926796475 2:16623523-16623545 CAGTAGGAGGAGAGGTCCTTTGG - Intronic
927141077 2:20131160-20131182 AAGAGAGACGACAGGGCCTGGGG - Intergenic
927926844 2:27019424-27019446 CAGAAAGAGGAGAGGACATGAGG + Intronic
928132793 2:28665298-28665320 CAGAGGAAGGGGAGGGCCTGTGG - Intergenic
931011362 2:57918295-57918317 CAGAAGGAGGAGAGGGGGAGTGG + Intronic
931196402 2:60055995-60056017 CAGAAGGAAGACAGAACCTGTGG + Intergenic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
932186220 2:69698546-69698568 AAGGATGACCAGAGGGCCTGGGG + Intronic
933714450 2:85349905-85349927 CACAAGCTCCAGAGGGCCTGGGG + Intronic
934751918 2:96799281-96799303 CAGGTGGGAGAGAGGGCCTGGGG - Intronic
934962414 2:98688351-98688373 CAGAAGGACGAGGGTCACTGGGG - Intronic
936038544 2:109130587-109130609 CAGAAGGCAGAGTGGGACTGGGG + Intronic
936048797 2:109207055-109207077 CATTTGGAGGAGAGGGCCTGGGG + Intronic
936069548 2:109356545-109356567 AAGGAGGAGGAGGGGGCCTGTGG - Intronic
936250669 2:110866150-110866172 CAGCAGGATGTGGGGGCCTGGGG + Intronic
936525706 2:113240222-113240244 CAGCATGGGGAGAGGGCCTGGGG - Intronic
937921713 2:127136127-127136149 CAGAAGGATGGGAAGGGCTGGGG + Intergenic
940255539 2:151724370-151724392 CAGAAGGAGCAGAGGATCTGTGG + Intronic
940971328 2:159899944-159899966 CAGGAAGGCGACAGGGCCTGGGG + Intronic
942572635 2:177329318-177329340 CAGAAGGAAGAGAGAGAGTGGGG - Intronic
942830906 2:180236834-180236856 CAGAAGGACAATATGGACTGTGG + Intergenic
943811416 2:192194244-192194266 CAGTAGGAGGTGAGGGGCTGAGG + Intronic
946065665 2:216985361-216985383 CTGGAAGAGGAGAGGGCCTGGGG - Intergenic
946360028 2:219213772-219213794 CACAAGGAAAAGGGGGCCTGAGG - Intronic
948157952 2:235799897-235799919 CAGAAGAAGAAGAGGGCCTGTGG - Intronic
948582867 2:238999729-238999751 CAGAAGGCAGAGTGGGGCTGCGG + Intergenic
1169354318 20:4894700-4894722 CAGACGAAAGGGAGGGCCTGGGG - Intronic
1169391706 20:5196250-5196272 CAGAAGGACAGGAGGGCTCGGGG - Exonic
1170289421 20:14751696-14751718 CAGAAGCACAAGAGGGCAAGTGG + Intronic
1171100537 20:22379625-22379647 CTGGAGGATGAGAGGCCCTGGGG - Intergenic
1173832820 20:46102975-46102997 CAGAAGGACTGGGGGGTCTGGGG - Intergenic
1173953272 20:47010305-47010327 CAGCAGCATGAGAGGGACTGTGG - Intronic
1174271211 20:49370254-49370276 CAGAAGGCAGAAAGGGCCTTTGG + Exonic
1175764038 20:61580914-61580936 CAGCAGGACCCGAGGACCTGAGG + Intronic
1175935268 20:62511099-62511121 CAGGAGGGCGAGAGGGCATCGGG - Intergenic
1176963611 21:15187636-15187658 CAGGAGGAAGAGAGGGAGTGGGG + Intergenic
1177675807 21:24296700-24296722 CAGAAGCACAAGAAGGCCTTTGG + Intergenic
1178889434 21:36508991-36509013 CAGCAGGAAGAAAGGGCCAGCGG - Intronic
1178921264 21:36740239-36740261 CTGAAGCACGAGGGGGACTGGGG - Intronic
1179030971 21:37719111-37719133 CAGGAGGAGGAGAGGGTGTGGGG + Intronic
1179433674 21:41344894-41344916 CAGAAGGATGAGATGGTCTATGG - Intronic
1179479655 21:41669219-41669241 CAGAGGGAGGAGGAGGCCTGCGG + Intergenic
1179578138 21:42320418-42320440 CCGAAGGCCGAGAGTGGCTGCGG - Intergenic
1179791759 21:43759898-43759920 CAGAAGGACCCCAGGCCCTGGGG + Exonic
1180184263 21:46131685-46131707 CAGCAGGTGGACAGGGCCTGGGG + Intronic
1182096332 22:27628469-27628491 CAGGAGGACGAGAGAGATTGGGG - Intergenic
1182334629 22:29575564-29575586 GAGCAGGAAGAGAGGGCTTGGGG - Intronic
1183482628 22:38073614-38073636 CTGAGGGATGACAGGGCCTGAGG - Intronic
1184278732 22:43425536-43425558 CAGGAGGACATGTGGGCCTGGGG - Intronic
1184414815 22:44346135-44346157 CAGGATGATGAGAGGTCCTGAGG + Intergenic
1185086151 22:48742150-48742172 GTGAAGGATGAGGGGGCCTGTGG - Intronic
950214822 3:11152010-11152032 CAGAAGTAGGAGTGGGGCTGTGG + Intronic
952967530 3:38630527-38630549 GAGGAGGAGGAGAGGGGCTGAGG + Intronic
953916993 3:46926631-46926653 CGGCAGGGCGAGAGGTCCTGGGG + Intronic
954283617 3:49602209-49602231 CAGCAGGTCAAGAGGACCTGAGG - Intronic
954317452 3:49808880-49808902 CAGAAGGAAGATAGGGCCTAGGG - Intronic
954757473 3:52849266-52849288 CAGAGGGCAGTGAGGGCCTGAGG + Intronic
954984547 3:54778137-54778159 CAGAAGGAAGAGAGAGAGTGGGG + Intronic
955892839 3:63668367-63668389 AAGAAGGAAGAGAGGAACTGGGG + Intronic
956672526 3:71704585-71704607 CCTAAGGACAACAGGGCCTGGGG + Intronic
958501203 3:94911290-94911312 GAGAAGGAGGAGATGACCTGAGG + Intergenic
960023040 3:112976996-112977018 CAGAAGGGCTAAATGGCCTGTGG + Intergenic
961125062 3:124409921-124409943 CAGAAAGAGGAGAGAGCCTGCGG + Intronic
961675914 3:128566587-128566609 CAGAAGGAAGAAAGGACCAGGGG - Intergenic
963930687 3:151001481-151001503 GACAAGGAGGAGAGGGCATGTGG - Intergenic
964381846 3:156105314-156105336 CAGAAGAATGAGAGGGCAAGAGG + Intronic
965997288 3:174899506-174899528 CAGAAGCAAGAGAGAGACTGTGG - Intronic
966077873 3:175960593-175960615 CAGAAGGACAAAAAGCCCTGGGG - Intergenic
968493051 4:900814-900836 CAGAAGGAAGAGAGGGAGGGAGG + Intronic
968812036 4:2804530-2804552 CAGCAGGACAGGAAGGCCTGGGG - Intronic
969568242 4:7992761-7992783 CAGCAGGAGGAGAGGCCCCGGGG - Intronic
969586672 4:8097874-8097896 CTGCAGGAGGAGAGAGCCTGTGG + Intronic
969842218 4:9891024-9891046 CTGAAGGAGGAGAAGGGCTGTGG - Intronic
969870162 4:10099528-10099550 CAGAATGACGTGTGGGCCTCAGG + Intronic
970643014 4:18088605-18088627 CAGAAGGGTGAGAGGGTCGGAGG - Intergenic
971260773 4:25054724-25054746 CAGAAGGCAGAAAGGCCCTGGGG + Intergenic
973015053 4:45127675-45127697 CAGGAGGAAGAGAGAGCATGGGG - Intergenic
976356399 4:84122671-84122693 CCGCAGGAGGAGAGGCCCTGAGG - Intergenic
977217875 4:94304268-94304290 AAGAAGAATGAGAAGGCCTGAGG - Intronic
980070975 4:128242767-128242789 CAGAGGCAAGAGAGGGCCTAGGG + Intergenic
980658028 4:135815324-135815346 CAGGAGGAGGAGAGAGACTGGGG - Intergenic
981050315 4:140303405-140303427 CAGCAGGGCCACAGGGCCTGAGG - Intronic
982353574 4:154443093-154443115 AAGAAGGAAGTGAGGGCATGAGG - Intronic
983375673 4:166924522-166924544 CAGAAGGGCAAGAGAGACTGTGG - Intronic
983940655 4:173531551-173531573 TAGAGGGAGGCGAGGGCCTGCGG + Intergenic
984695137 4:182771374-182771396 CAGGAGGGCTAGTGGGCCTGGGG + Intronic
988390087 5:30616480-30616502 CAGAAGGAAGAGAGAGAGTGGGG + Intergenic
988893953 5:35651391-35651413 CAGCAGGAGGAGAAGGCCTGGGG + Intronic
990324909 5:54665577-54665599 CAGAAGCACAAAAGGGTCTGAGG + Intergenic
990948371 5:61272820-61272842 CAGAATAAAGAGAGGGGCTGAGG - Intergenic
991022013 5:61989166-61989188 AAGAAGGAGGAGAGGTCCTTGGG + Intergenic
997527232 5:134561190-134561212 CACAAGGTGGAGAGGGTCTGAGG - Intronic
997738876 5:136236291-136236313 CAGAAGCACCTGAGGGGCTGAGG - Intronic
997815814 5:137016057-137016079 CAGAAGAAGGAGAAGGCCTAGGG + Intronic
997997185 5:138596378-138596400 CAGAAGTAGGAGTGGACCTGAGG + Intergenic
1000988425 5:167886427-167886449 CAGAAGGATGAGAGGATATGTGG + Intronic
1002284342 5:178152336-178152358 CAGAAGAAAGAGTGGGCCTCTGG - Intronic
1002394549 5:178942542-178942564 CAGAAGGAGGAGAGAGAATGGGG + Intronic
1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG + Intergenic
1004527872 6:16426253-16426275 CAAAAGGAGGAGAGGGCTGGTGG + Intronic
1005869606 6:29964946-29964968 CTGAAGGAAGAGAGAGCCAGCGG + Intergenic
1006060425 6:31414629-31414651 CTGAAGGAGAGGAGGGCCTGGGG + Intronic
1006180638 6:32151652-32151674 CAGAAAGAGGAGGGGGACTGGGG + Intronic
1006248188 6:32758395-32758417 CAGAAGGAAAAGAGGGAGTGAGG - Intronic
1006380149 6:33692596-33692618 CAGAAGGAAATGAGGGCCTCTGG - Intronic
1011447798 6:87461540-87461562 CAGAAGGATGAGAGTGCCCAGGG - Intronic
1012625013 6:101393895-101393917 CAAGAGGACGGGAGGGACTGCGG + Intergenic
1014177768 6:118349012-118349034 CAGAAGGAAGAGAGGGAGAGAGG - Intergenic
1015182806 6:130378971-130378993 CAGAAGGACGAGAGCATATGGGG + Intronic
1016370239 6:143366157-143366179 AAGAAGGAGGAGAGTCCCTGAGG - Intergenic
1017790733 6:157796514-157796536 CAGCAGGACAAGAGAGACTGGGG + Intronic
1017882708 6:158572868-158572890 CAGAGGGAGGAGTGGGCTTGTGG + Intronic
1018172243 6:161152289-161152311 CAGAGGGGCGAGGGGGCCAGGGG + Intronic
1018602909 6:165564312-165564334 CAGCAGGACTAGAGAGCCTTGGG - Intronic
1018845310 6:167551708-167551730 AAGAAGGAAGCCAGGGCCTGTGG + Intergenic
1018896123 6:168018785-168018807 CGGAAGGACGTCAGTGCCTGAGG + Intronic
1018908470 6:168088603-168088625 CATCAGGACCAGAGGGCCAGAGG + Intergenic
1018987538 6:168649148-168649170 CAGAAAGCCGAGTGGGACTGAGG - Intronic
1019075675 6:169386416-169386438 CAGAAGAAAGAAATGGCCTGTGG + Intergenic
1021384500 7:20011430-20011452 CAAAAGAAAGAGAGAGCCTGGGG + Intergenic
1021934337 7:25615125-25615147 CAGAGGGAGGAGAGGGCCCTTGG - Intergenic
1022288826 7:28981079-28981101 CAGATGGGTGAGATGGCCTGAGG - Intergenic
1024001884 7:45195155-45195177 CAGCAGGACAGGAGGGGCTGAGG + Intergenic
1025261927 7:57425643-57425665 CAGCAGGACGGGGGGGCCTCTGG + Intergenic
1026433617 7:70373166-70373188 AAGAAGGATGAGAGGGTCTGTGG + Intronic
1026472757 7:70708268-70708290 CAGAAGCCCAAGAGGTCCTGCGG - Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028893781 7:96018148-96018170 CAGATGGCAGAGAGGGCTTGTGG - Intronic
1029137836 7:98387198-98387220 CAGGCGGAGGAGAGGGGCTGCGG + Intronic
1031631983 7:124054193-124054215 CAGAAAGATGAGAGTGCCAGGGG - Intergenic
1032096034 7:128938946-128938968 CAGCAGGAGGAGAGGTCCAGAGG + Intronic
1033227989 7:139575856-139575878 CAGAAGGACAAAAGAGCATGAGG - Intronic
1035085910 7:156257759-156257781 CAGGAGGAAGAGAGGGACGGGGG + Intergenic
1035643605 8:1201477-1201499 CAGAAGGAAGCCAGGTCCTGGGG + Intergenic
1036036918 8:5029795-5029817 CAGGAGGAAGAGAGAGCCAGGGG - Intergenic
1036655512 8:10674650-10674672 CACAAGGTCGGGAGCGCCTGCGG + Exonic
1037860113 8:22399018-22399040 CAGCAGGAAGAGCTGGCCTGGGG + Intronic
1038493522 8:27986177-27986199 CAGGCGGAGGAGAAGGCCTGGGG - Intronic
1038500298 8:28038082-28038104 CCAAGGGAAGAGAGGGCCTGGGG - Intronic
1038926869 8:32150487-32150509 CAGAAGGGCAAGAGGCCCTAGGG - Intronic
1039285397 8:36034405-36034427 CAGAAGGAAGAGAGTGAGTGGGG + Intergenic
1039738298 8:40356060-40356082 CTGAAGGACGAGAAGGGCTTAGG + Intergenic
1041177080 8:55207873-55207895 GAGGAAGAAGAGAGGGCCTGGGG - Intronic
1041424582 8:57705960-57705982 CAGAAGGACGAAAGAGCCGAGGG + Intergenic
1041659990 8:60392069-60392091 CAGAAGGAGGCGAGGGAGTGAGG - Intergenic
1043553546 8:81403087-81403109 CAGGAGGATGAAAGGACCTGGGG - Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049317741 8:141978236-141978258 CAGACGGAGGAGAGGACCCGGGG - Intergenic
1049388666 8:142357135-142357157 AAGAAGGACAGGAGGGCCAGGGG + Intronic
1052857908 9:33418408-33418430 CAGCAGGAAGAGGGGGCTTGAGG + Intergenic
1054944144 9:70776752-70776774 CAGAAGGTACAGAGGGCTTGTGG + Intronic
1055169346 9:73236046-73236068 CAGAAGCACATGGGGGCCTGGGG + Intergenic
1055280735 9:74671181-74671203 AAGAAGGGAGAGAGGGTCTGAGG + Intronic
1056615249 9:88160057-88160079 CAGAGGGCAGGGAGGGCCTGTGG + Intergenic
1056759953 9:89407305-89407327 CAGCAGGAAGAGAAGGACTGAGG - Intronic
1060118917 9:120969607-120969629 CAGAGGGATGTGAGGGCCTTGGG + Intronic
1060463067 9:123877041-123877063 CAGAAGGGTGGGAGGGGCTGAGG + Intronic
1060488659 9:124065655-124065677 CAGCAGGAAGAGATGGTCTGGGG + Intergenic
1060705094 9:125791552-125791574 CAGGAGGAAGAGAGGGCAGGGGG - Intronic
1061052846 9:128206233-128206255 CAGAAGCCCGGGTGGGCCTGGGG - Intronic
1061247812 9:129410071-129410093 CAGAAGGATGGGAGGACCGGAGG + Intergenic
1061562961 9:131418271-131418293 CAGAAGGAAGAGGGGGCCAGGGG - Intronic
1061573872 9:131494301-131494323 CACAAGGAAGGAAGGGCCTGCGG - Intronic
1061903247 9:133683759-133683781 CAGAGGGACTGGAGGTCCTGGGG - Intronic
1062007808 9:134250199-134250221 CACACGGAAGAAAGGGCCTGTGG + Intergenic
1062447254 9:136600139-136600161 CACATGGACGGGAGGCCCTGGGG - Intergenic
1062516757 9:136940705-136940727 CAGGAGGCCGAGGGGGCCTTGGG + Exonic
1062561142 9:137142611-137142633 CCTCAGGACGAGAGGGCCCGTGG + Intronic
1203786633 EBV:131972-131994 CGGAATGAGAAGAGGGCCTGCGG + Intergenic
1185502755 X:610941-610963 TGGAAGGTCAAGAGGGCCTGAGG - Intergenic
1186611553 X:11142816-11142838 CAGAAGGGAAAGAGGCCCTGTGG + Intronic
1186944044 X:14545307-14545329 CAGAAGGGCAAGAGGGCATAAGG + Intronic
1187399961 X:18950807-18950829 CAGAAGGGCAAGAGAGCCAGAGG - Intronic
1188111619 X:26200642-26200664 CATGAGGAAGAGAGAGCCTGAGG + Intergenic
1188405044 X:29797471-29797493 CAGAAGGATGAGGGGGCCTGAGG - Intronic
1188537254 X:31211180-31211202 CAGGAGGACGGGAGGACGTGAGG + Intronic
1189047771 X:37611475-37611497 AACAAGGAGGATAGGGCCTGTGG + Intronic
1189534417 X:41922803-41922825 GAGAAGGACGAGAGGGGAAGAGG + Intronic
1192264636 X:69530125-69530147 CAGAATGGCCAGAGGGCCTCAGG + Exonic
1192368828 X:70496986-70497008 GACAAGTACGAGAGGGCCAGGGG + Intronic
1192938685 X:75889319-75889341 AAAAAGGAGGAGAGGGGCTGGGG - Intergenic
1195100454 X:101550597-101550619 CCAGAGGGCGAGAGGGCCTGTGG + Exonic
1195200521 X:102546260-102546282 TAAAAGGAGGAGAGGGGCTGGGG + Intergenic
1195966611 X:110435017-110435039 CAGAAGGAAGGGAGGGACAGAGG + Intronic
1197711730 X:129676477-129676499 CAGGAGGAGGAGTGGGTCTGGGG - Intergenic
1199383101 X:147193441-147193463 CAGGAGGAAGAGAGAGGCTGGGG - Intergenic