ID: 1049104597

View in Genome Browser
Species Human (GRCh38)
Location 8:140603974-140603996
Sequence CATGCAGCTCCTTCACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 282}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049104597_1049104603 8 Left 1049104597 8:140603974-140603996 CCTCAGGGTGAAGGAGCTGCATG 0: 1
1: 0
2: 2
3: 22
4: 282
Right 1049104603 8:140604005-140604027 CCATCATCCAGGCCCATGAAAGG No data
1049104597_1049104600 -3 Left 1049104597 8:140603974-140603996 CCTCAGGGTGAAGGAGCTGCATG 0: 1
1: 0
2: 2
3: 22
4: 282
Right 1049104600 8:140603994-140604016 ATGGAGTGGTCCCATCATCCAGG No data
1049104597_1049104606 20 Left 1049104597 8:140603974-140603996 CCTCAGGGTGAAGGAGCTGCATG 0: 1
1: 0
2: 2
3: 22
4: 282
Right 1049104606 8:140604017-140604039 CCCATGAAAGGCCCTAGCCAAGG No data
1049104597_1049104608 23 Left 1049104597 8:140603974-140603996 CCTCAGGGTGAAGGAGCTGCATG 0: 1
1: 0
2: 2
3: 22
4: 282
Right 1049104608 8:140604020-140604042 ATGAAAGGCCCTAGCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049104597 Original CRISPR CATGCAGCTCCTTCACCCTG AGG (reversed) Intronic
900177644 1:1297924-1297946 CATGCAGCTCCTGCAGGCAGTGG + Exonic
900521060 1:3105799-3105821 TGTGCAGCCCCTTCCCCCTGCGG + Intronic
900818686 1:4869856-4869878 CCTGCAGCTCCTGCACCATCAGG - Intergenic
902512652 1:16974746-16974768 CAGGCCCCTCCTTCAGCCTGTGG - Exonic
903275881 1:22221485-22221507 CATTCAGCAACTTCACGCTGCGG - Intergenic
905035809 1:34917854-34917876 CATGATGCTCCTTCTCTCTGGGG + Intronic
905294280 1:36944372-36944394 CCTGCAGCCCCTTCGGCCTGAGG - Intronic
905546083 1:38801527-38801549 CATGCATTTCCTTCCCTCTGAGG + Intergenic
906052777 1:42888373-42888395 CCTGGAGCTCCTTCACCAGGAGG + Intergenic
907077905 1:51594951-51594973 GCTGCAGCCCCTTCATCCTGCGG + Intronic
915118759 1:153615772-153615794 CACTCCTCTCCTTCACCCTGAGG - Intronic
915950872 1:160189245-160189267 CATGCTGCCACTGCACCCTGAGG - Intergenic
919083245 1:192891418-192891440 CATGCACTTCCTTCCCTCTGAGG - Intergenic
919482608 1:198108237-198108259 CCTGCAGCTCCTCCAGGCTGGGG - Intergenic
919614524 1:199788711-199788733 CATGCAGCTCCTTTACATGGTGG + Intergenic
919926164 1:202192968-202192990 CCTGCAGCTCAGCCACCCTGAGG - Intergenic
921181822 1:212637380-212637402 CATGTAGCTCATTCTCCCTGTGG - Intergenic
921868451 1:220110980-220111002 CATGCAGCCCCTTTATACTGAGG - Intronic
923441467 1:234024604-234024626 CACCCAGCTCCTTCATCATGTGG - Intronic
924744328 1:246818332-246818354 CAGGCCCCTCCTTCAGCCTGTGG + Intergenic
1062772177 10:110967-110989 CTTGCATCCCCTTCACCCTCCGG - Intergenic
1069935924 10:71915962-71915984 CATGCTGCTCCTCCAGCCTCAGG - Intergenic
1070976675 10:80610846-80610868 GAGGCAGCTCCTTCAGGCTGAGG - Intronic
1071392424 10:85189341-85189363 CTTGCAGCACCATCATCCTGGGG + Intergenic
1072792562 10:98328929-98328951 GCTGCTGCTCCTTCAGCCTGGGG - Intergenic
1073287433 10:102397250-102397272 CATGCAGTTCTTTCTTCCTGAGG - Intronic
1076017515 10:127040014-127040036 CGTGCAGCTCCATCTCCCTGTGG + Intronic
1076380797 10:130023473-130023495 CCTGAAGCTCTTTGACCCTGAGG - Intergenic
1076915890 10:133423099-133423121 CCAGCAGCTCCTGCACCCAGTGG + Exonic
1077055917 11:593054-593076 CCTGCTCCTCCTTCACCCTCTGG + Intronic
1078141917 11:8699221-8699243 CAGGCAGCTCCTTCAGTTTGGGG + Exonic
1078205779 11:9228164-9228186 CATGCAGCTCCTAAAACCTTTGG + Intronic
1078360897 11:10666934-10666956 AGTGGAGCTCCTGCACCCTGGGG + Intronic
1078649478 11:13174938-13174960 CACACAGCTACTTCACCATGAGG + Intergenic
1079298556 11:19256908-19256930 CATGCAGCACCTTTACACAGTGG + Intergenic
1080329209 11:31115926-31115948 GAAGCAGCTCCTTTACACTGAGG + Intronic
1080633825 11:34105868-34105890 GATGCAGAGCCTTCATCCTGAGG - Intronic
1080749962 11:35142147-35142169 CATGCATCTCCTTGTCTCTGTGG + Intronic
1082772713 11:57220809-57220831 CATGCAGCTCCTGGATCCTCAGG - Intergenic
1084501076 11:69535889-69535911 CAAGCAGCTCCTTCACACTCTGG - Intergenic
1084907456 11:72358886-72358908 CAAGCAGCTCCTTGACAGTGCGG + Exonic
1085817464 11:79755244-79755266 CATGCTGTTCCTTCTGCCTGGGG + Intergenic
1086119053 11:83286497-83286519 CATCCTGCTGCTTCACCCTCTGG + Intergenic
1088981991 11:114872178-114872200 CAGGCAGCTTCTAGACCCTGGGG + Intergenic
1090105724 11:123852106-123852128 CATGGAGCTACTGCACACTGGGG - Intergenic
1091626072 12:2121983-2122005 CATGTAGCCCCTTCACCCCTCGG + Intronic
1093351728 12:18111006-18111028 CAAGCATATCCTTCAGCCTGGGG + Intronic
1094787104 12:33860925-33860947 CATGCATCTCGTACAGCCTGTGG + Intergenic
1097906196 12:64921944-64921966 CAAGAAGCTGCTTCTCCCTGGGG + Intergenic
1099502916 12:83435735-83435757 CATGCACCTTCTTCACCAGGAGG - Intergenic
1099940001 12:89175333-89175355 CCTGCAGATGCTTCACTCTGAGG - Intergenic
1104680081 12:130744162-130744184 CATGCAGAGCCTTCCCCCAGTGG - Intergenic
1104932638 12:132347872-132347894 CACGCAGCTGCTTCATTCTGAGG + Intergenic
1106397082 13:29391465-29391487 CATGCAGCTCCTTACTCCAGTGG - Intronic
1106636806 13:31537676-31537698 AATGCATCTCCTTTTCCCTGTGG - Intergenic
1107513583 13:41107888-41107910 CATGCACCTCCTCCCCACTGAGG + Intergenic
1110059042 13:71017826-71017848 CATGCACCTTCTTCACCAGGTGG - Intergenic
1110870806 13:80450593-80450615 CACTCAGCTTCCTCACCCTGTGG - Intergenic
1113970698 13:114186049-114186071 CATGCACTTCCTCCACACTGAGG + Intergenic
1114951656 14:27761835-27761857 AGTGCAGCTGCTTCACCCTCTGG - Intergenic
1115865124 14:37737287-37737309 CATGAATCCCCTTAACCCTGGGG - Intronic
1119657109 14:76425139-76425161 AAGGCAGCTCCTGCTCCCTGTGG - Intronic
1120654283 14:87170277-87170299 CAGGCAGCTCCTTCACGAAGTGG + Intergenic
1121349286 14:93160712-93160734 CTGGCTGCTCCTTCAGCCTGGGG + Intergenic
1121614136 14:95301531-95301553 CTTGCAGCCATTTCACCCTGTGG - Intronic
1126185719 15:45829301-45829323 CATGCACTTCCTTCCCTCTGAGG - Intergenic
1126222051 15:46225384-46225406 CATGTAGCTGCTTCACCAAGAGG - Intergenic
1126384882 15:48084090-48084112 CCTGCAGCAACTTCACCTTGGGG - Intergenic
1126798240 15:52277732-52277754 CGTGCAGCTCCCTGTCCCTGGGG - Intronic
1128183537 15:65625244-65625266 CATGCAGGTCCATCACTGTGTGG + Exonic
1128714043 15:69893956-69893978 CATGCAGCAAGTTCTCCCTGGGG + Intergenic
1130052554 15:80495854-80495876 CTTGCAGCTCCATCTCTCTGAGG + Intronic
1131661324 15:94521051-94521073 CATGCAGCTCCTTCTGCACGGGG - Intergenic
1132375947 15:101328224-101328246 CCTGCAGCGTCTTCTCCCTGAGG + Intronic
1133076614 16:3285175-3285197 CTAGCAGCTCCTGCAGCCTGGGG - Exonic
1133303828 16:4798094-4798116 CATGCAGCTGGTACACCGTGAGG + Exonic
1134402229 16:13920532-13920554 GATGCAGGTCCCTCACACTGCGG + Intronic
1137512461 16:49113704-49113726 CTTGCTGCTCCTTGAACCTGTGG - Intergenic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1138882987 16:61038800-61038822 CCTGCAGATCTTTCACTCTGTGG - Intergenic
1139415675 16:66807128-66807150 CATGCAGTTGCTTGAGCCTGGGG - Intronic
1140854676 16:78967697-78967719 CATGGTGATCCTTCATCCTGTGG - Intronic
1141410515 16:83829869-83829891 CCTGCAGCTCCATCACCATGGGG - Intergenic
1142242110 16:88952288-88952310 GAGGCAGCTCCCTCACCCCGTGG - Intronic
1142242129 16:88952369-88952391 GCGGCAGCTCCCTCACCCTGTGG - Intronic
1144836884 17:18161200-18161222 CAGGCAGCTCCTGTCCCCTGAGG - Intronic
1146086939 17:29838547-29838569 CATGCACTTCCTTCCCTCTGAGG + Intronic
1146277580 17:31525084-31525106 CCTCCAGCTCATGCACCCTGAGG - Exonic
1146689797 17:34865473-34865495 CCTGCGGCTCCTCCACCCTGGGG + Intergenic
1147455693 17:40536774-40536796 CATGCTCATCCTTCTCCCTGAGG + Intergenic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1149936104 17:60808859-60808881 TATGCTGCTCCTTCTCCATGAGG - Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1150625370 17:66837850-66837872 CAAGCCTCTCCTTCTCCCTGGGG - Intronic
1151170103 17:72238607-72238629 CTTGGAGCTCCTCCACTCTGTGG - Intergenic
1152527289 17:80895635-80895657 CACGCAGCAGCTTCACTCTGAGG - Intronic
1153111595 18:1597068-1597090 GATGCAGCTACTTGACCCTTGGG + Intergenic
1157434438 18:47656554-47656576 CATGCTGCTCCTTCTGTCTGGGG - Intergenic
1158328332 18:56333877-56333899 CATGCAGTTCTTACAGCCTGGGG + Intergenic
1159122507 18:64187231-64187253 CAGGCAGCTTCTAAACCCTGTGG + Intergenic
1160149696 18:76389773-76389795 CAAGCAGCTATTTCACTCTGAGG + Intronic
1160225773 18:77009667-77009689 CCTGCAGCTGCTTTTCCCTGGGG + Intronic
1161361084 19:3850147-3850169 CATGCCCCTCCTTCTCCCAGAGG - Intronic
1161617194 19:5277970-5277992 CTTCCAGCTCCTTGACGCTGGGG - Intronic
1161747995 19:6073366-6073388 CTTCCAGCTCCTTGACGCTGGGG - Intronic
1162117745 19:8441802-8441824 CAATCAGCTCCTCCACTCTGAGG - Intronic
1162724142 19:12679817-12679839 CCCGGAGCTCCTTCCCCCTGAGG + Exonic
1163640843 19:18461170-18461192 CAGGCAGCTGATTCACACTGAGG + Intronic
1164530240 19:29042918-29042940 CATCCTGCTCCTTCACAGTGTGG + Intergenic
1164757769 19:30703075-30703097 CATGCAGCTGCCTCTGCCTGGGG - Intronic
1165120967 19:33558239-33558261 CCTGCAGATCCTTCCCTCTGGGG + Intergenic
1165383894 19:35499243-35499265 CATGCAGCTTCTACTGCCTGTGG - Intronic
1165745421 19:38227813-38227835 CCTGCAGCTCCTTCTCCCCAGGG + Intronic
1165930538 19:39355546-39355568 CATTCAGCTCCATCCCCCTCTGG - Intronic
1166186334 19:41141549-41141571 CTTGCTGTTCCTTCTCCCTGAGG - Intergenic
1166267965 19:41696650-41696672 CCTGCATCACCTTCTCCCTGTGG - Intronic
1166496670 19:43307875-43307897 CTTGCACCACCTTCTCCCTGTGG + Intergenic
1167503935 19:49861695-49861717 CATCCAGCTCCTTCCCCCACAGG - Exonic
1168265871 19:55223743-55223765 CCACCAGCTCCCTCACCCTGAGG - Intergenic
925125031 2:1448295-1448317 CATGCAGCTCCTGCACGCATCGG + Intronic
926132343 2:10311700-10311722 CCTGTAGCTCCTTCCCCCTGTGG + Intronic
926149262 2:10415626-10415648 CATGTGGCTCCTTCACCATGCGG - Intronic
926368888 2:12160856-12160878 CAGGCAGCTCCACCATCCTGAGG - Intergenic
926741107 2:16111597-16111619 CATGGAGGTCCTTCACACAGCGG + Intergenic
926749753 2:16189336-16189358 CATGCTGCTCCTTCTGCCTGGGG - Intergenic
928696096 2:33851693-33851715 CGTGCAGGTCCTTCTCCCTGGGG - Intergenic
931008490 2:57880213-57880235 CACACAGTTCCTTAACCCTGGGG + Intergenic
931257464 2:60585659-60585681 TTTGCAGCTCCGTCACCCTCTGG - Intergenic
931263266 2:60638471-60638493 CATGCAGCTCCTTCGTGCTCTGG - Intergenic
932570701 2:72936927-72936949 CATGCAGCACCTGCACGCCGAGG - Intergenic
932912884 2:75822668-75822690 CATGCAGCTCCCTCAAGCAGGGG - Intergenic
933220638 2:79683738-79683760 CCTGCAGCTCCTGCAACTTGTGG - Intronic
934252115 2:90364824-90364846 AATGCAGCACCCTCACCCAGAGG - Intergenic
934257328 2:91438122-91438144 AATGCAGCACCCTCACCCAGAGG + Intergenic
934485700 2:94707859-94707881 AATGCAGCTGCTTCACCCTCTGG + Intergenic
934646221 2:96060647-96060669 CCTCCAGCTCCTGCACCGTGAGG + Intergenic
935285865 2:101563157-101563179 CAGGCAGCTCCCTTCCCCTGTGG - Intergenic
935568546 2:104635149-104635171 CATGCTGGTCCTTCTGCCTGGGG + Intergenic
935636960 2:105256381-105256403 CCTGCTGCTCCTTCTGCCTGGGG + Intergenic
936637133 2:114271682-114271704 CATGCAGCACCCTCATCCAGGGG + Intergenic
937683363 2:124668285-124668307 TATGGATCTCCTTCTCCCTGAGG + Intronic
938201914 2:129379208-129379230 AATGCAGCTCCAGCAGCCTGTGG - Intergenic
940117581 2:150225870-150225892 CAAGAAGCTGCTTCTCCCTGGGG + Intergenic
941431294 2:165417507-165417529 CAGGAATTTCCTTCACCCTGTGG + Intergenic
945775628 2:214103154-214103176 CAAGAAGCTGCTTCTCCCTGGGG + Intronic
947480852 2:230498738-230498760 CAAGCAGCTCCTGGGCCCTGGGG - Intronic
948140897 2:235670974-235670996 CACGCGGCTACTTCAGCCTGCGG + Intronic
948216924 2:236239061-236239083 CATGCAGGTCCATGTCCCTGGGG - Intronic
948288221 2:236803794-236803816 CATGGGGCTCCTTTACCCTCTGG + Intergenic
948359903 2:237412780-237412802 CCTGCAGCTCTAGCACCCTGTGG + Intronic
948770859 2:240250726-240250748 CATGGGGCTCCGTCAGCCTGTGG - Intergenic
948998584 2:241597811-241597833 CATGCAGCCCCTGCACCCTGGGG - Intronic
1170358660 20:15520445-15520467 CATCCATCCCTTTCACCCTGGGG + Intronic
1172010747 20:31844504-31844526 CCTGCAGGTCCCTCACCCTCCGG - Exonic
1172134750 20:32679470-32679492 CTTGCTGCTCCTTCCCCCTCTGG + Intergenic
1174195752 20:48771677-48771699 CGTGCAGCCCCATCACCATGCGG + Intronic
1175391785 20:58632145-58632167 CATGGAGCTCCTTCTCAGTGGGG - Intergenic
1175709508 20:61207937-61207959 CGTCCAGCTGCTTCACCATGAGG - Intergenic
1176021313 20:62963696-62963718 CTGGGCGCTCCTTCACCCTGCGG - Intronic
1178914045 21:36697294-36697316 CTTGGAGCTCCTTCTCCCAGAGG + Intergenic
1179902573 21:44401675-44401697 CCTGCAGCCTCTTCTCCCTGCGG - Exonic
1179915837 21:44477649-44477671 CCTGGAGCTCCTGCACCATGGGG + Intergenic
1179948237 21:44695024-44695046 CAAGCAGCTCCTCCAGCCTGTGG - Intronic
1180937841 22:19637756-19637778 CATGCAGCATCTGCACCGTGGGG + Intergenic
1181398349 22:22636575-22636597 AATGCTGCTGCTTCATCCTGTGG + Intergenic
1181734378 22:24870251-24870273 CATGGAGCCCCTTCAGCCTTGGG - Intronic
1181865590 22:25852064-25852086 CATTCAGCACCAGCACCCTGGGG + Intronic
1182863662 22:33583287-33583309 CATGCACTGCCTTCATCCTGTGG - Intronic
1183343826 22:37296090-37296112 CATGCAGCCCCCACACCCTGTGG - Intronic
1183482671 22:38073781-38073803 CATCCATCTCCTTCACCTTCAGG - Exonic
1185418040 22:50720689-50720711 CCTGCAGCTGCTTCACCAGGGGG - Intergenic
950267706 3:11587279-11587301 CATGCAGCTCCTTCATCGGCAGG - Intronic
950500758 3:13362053-13362075 CATGAAGCTCCTTCAGGGTGAGG - Intronic
950911164 3:16593671-16593693 CATGAAGCTACTCCACCCTCTGG - Exonic
952182632 3:30934333-30934355 CATGCTGATGCTTCCCCCTGTGG - Intergenic
952542646 3:34382905-34382927 CATGCAGCACATCCACCCTATGG - Intergenic
952981334 3:38738512-38738534 CATGCACCCCCTTCAACCTCTGG + Intronic
954720178 3:52554784-52554806 CATGCAGCCACTTCACCCTGGGG - Exonic
955990134 3:64617772-64617794 CAAGAATCTCCTTCCCCCTGTGG - Intronic
956147472 3:66205707-66205729 GAGGCAGCCCCTTGACCCTGTGG + Intronic
957530101 3:81429916-81429938 CATTCTGCCCCTTCACCATGAGG - Intergenic
960485276 3:118244922-118244944 CGTGCAGCTTCTTCACAGTGGGG - Intergenic
961590390 3:127975235-127975257 CCTCCAGATCCTTCACCCTTTGG - Intronic
961780738 3:129318831-129318853 CATGCCACTCCTCCCCCCTGCGG - Intergenic
962044313 3:131739421-131739443 CATGCTGCTGCTTCCCCCTGTGG + Intronic
962315914 3:134359487-134359509 CATGGAGCACCTTTAACCTGAGG + Exonic
962957471 3:140279375-140279397 CATGCAGCACCTTCAACTTGTGG - Intronic
963065504 3:141260683-141260705 CATGCAGCCCCTGCTGCCTGGGG - Intronic
966146917 3:176823025-176823047 CCTGCAGCACCATCGCCCTGGGG + Intergenic
968581946 4:1399323-1399345 CACCCAGCTCCTACACCCTAAGG - Intergenic
968582642 4:1402187-1402209 CAGGCAGCCCCTTCTCCCCGGGG + Intergenic
969197081 4:5571582-5571604 CTTGCTGCTCCTTCATCCTGTGG - Intronic
969656754 4:8503189-8503211 AATGCGGCTCCTGCAGCCTGGGG - Intergenic
969966534 4:11002703-11002725 CACCCAGCTTCTCCACCCTGAGG + Intergenic
970827174 4:20290022-20290044 CATGCAGATTCTTTAGCCTGTGG + Intronic
971346703 4:25818189-25818211 CTTTCAGCTCCTTCTCCCAGGGG + Exonic
971938811 4:33188741-33188763 CATGCACCTCCTCCACTCCGAGG - Intergenic
972466920 4:39366247-39366269 CAGCCAGCGCCTTCATCCTGGGG - Exonic
975856767 4:78632902-78632924 CATGCAGCTGTCTCACCCTAAGG + Intergenic
976950972 4:90829981-90830003 CAAGAAGCTGCTTCTCCCTGAGG + Intronic
980594418 4:134934555-134934577 CATTCATTTACTTCACCCTGGGG + Intergenic
982740798 4:159054933-159054955 AATACAGCTGCTTCAGCCTGGGG - Intergenic
985786486 5:1898007-1898029 CGGGCAGCTCCTTCACCTTGTGG - Intergenic
987416817 5:17670784-17670806 CAGGCTGCTCGTTCGCCCTGTGG + Intergenic
987506636 5:18782705-18782727 AAGGCAGCTCTTTTACCCTGAGG - Intergenic
991494499 5:67214272-67214294 GGTGCAGCTCCCTCAGCCTGGGG - Intergenic
991549168 5:67817761-67817783 CCTGCAGCTTCTCCACGCTGAGG - Intergenic
994687315 5:102971187-102971209 CATGCATCTGCTTCAACCTGTGG - Intronic
994851262 5:105057475-105057497 CATGCACTTCCTTCCCTCTGAGG + Intergenic
995615517 5:113958963-113958985 CATTCAGCTTCTTCACCCCTAGG - Intergenic
997336728 5:133113911-133113933 CAAACATCTCCTCCACCCTGGGG - Intergenic
998725856 5:145013897-145013919 CATGTATGTCGTTCACCCTGTGG + Intergenic
999246702 5:150158870-150158892 AGTGCAGCACCATCACCCTGGGG + Intergenic
999859927 5:155633893-155633915 CATGCACTTCCTCCACTCTGAGG + Intergenic
1001170929 5:169418261-169418283 CATTCTACTCCATCACCCTGAGG - Intergenic
1001677390 5:173529983-173530005 CATGCATTTCCTTCACGCTTAGG + Intergenic
1001960462 5:175877546-175877568 CATGAAGCTACTTCACACTTTGG + Intronic
1002501207 5:179648849-179648871 CCTGCAGCTCCTACAGGCTGGGG + Intergenic
1002935041 6:1664314-1664336 CAAGCATCTCCTTCACTCTCTGG + Intronic
1004791213 6:19028494-19028516 CATGCACCTCTTACACTCTGTGG + Intergenic
1004854339 6:19734149-19734171 CATGCAGCTGCATCACCTTTGGG - Intergenic
1005681954 6:28216927-28216949 CATGCAGCCTCTTCTCCCTGGGG - Intergenic
1006678063 6:35777766-35777788 CTTGGAGCTCCTGTACCCTGGGG + Intronic
1008258531 6:49335073-49335095 CATGCAGATACTTCAGCCGGGGG - Intergenic
1008838873 6:55874301-55874323 CAAGCAGCTCCTTTACCATTAGG + Intronic
1010272437 6:73929433-73929455 CATGCCTCTCCTTCATCCTGAGG - Intergenic
1011237305 6:85231639-85231661 CATGCACTTCCTTGACTCTGGGG - Intergenic
1013176859 6:107685248-107685270 CATGCAGCACTTCCATCCTGAGG - Intergenic
1014188106 6:118458541-118458563 AATAGAGCTCCTCCACCCTGGGG + Intergenic
1014943393 6:127469773-127469795 CACACAGCTCCATCACACTGTGG - Intronic
1017240642 6:152164309-152164331 CCTTCAGCTTCTTCACCCTGTGG + Exonic
1017726303 6:157278374-157278396 CCTACAGCTGCCTCACCCTGAGG + Intergenic
1018632533 6:165833598-165833620 CAAGCAGTTCCTTCAGCATGAGG + Intronic
1018937700 6:168284365-168284387 CATGCTCCTCCTTCTCCCTCTGG + Intergenic
1019579802 7:1755900-1755922 GATCCTGCTCCCTCACCCTGGGG - Intergenic
1021577693 7:22119245-22119267 CATGCAGCATCCTCTCCCTGTGG + Exonic
1022657060 7:32329269-32329291 TAAGCAGCTCTTTCACACTGAGG + Intergenic
1022874272 7:34512744-34512766 GATACAGCTCTTTCAGCCTGTGG + Intergenic
1023849443 7:44141878-44141900 GATGGAGCTCCTTAACCCTCTGG - Intergenic
1024349511 7:48349488-48349510 GATGCATCTCCATCATCCTGAGG - Intronic
1024716878 7:52088704-52088726 CATGCAGGGCTCTCACCCTGAGG + Intergenic
1028392617 7:90334387-90334409 GAGGCAGCTCCCTCAGCCTGCGG + Intergenic
1028736040 7:94213498-94213520 CATGCAGCTCCTTAAACCAGAGG + Intergenic
1029130150 7:98323686-98323708 GAAGCAGCTCTTTCACTCTGCGG + Intronic
1030358598 7:108570206-108570228 CATGCAGCCCATTGTCCCTGCGG - Intronic
1031742976 7:125457353-125457375 CTTGCTGCACCATCACCCTGGGG + Intergenic
1034579025 7:152026407-152026429 CACACAGCTCCCTCACCCTTTGG + Intronic
1036434666 8:8722846-8722868 CAGGCACCGCCTTCACCCTTCGG + Intergenic
1038163560 8:25063381-25063403 CAGGCAGCTCCTCCACCAGGAGG + Intergenic
1038280826 8:26162814-26162836 CATGCAGCTCCATCTTCCTCAGG + Intergenic
1039069641 8:33637744-33637766 CATGCAGCTCATTTAGCATGAGG - Intergenic
1043890497 8:85647625-85647647 CATTCAGTCCCTCCACCCTGAGG + Intergenic
1045319410 8:101070328-101070350 CATCCAGCTCACTCACTCTGAGG + Intergenic
1049104597 8:140603974-140603996 CATGCAGCTCCTTCACCCTGAGG - Intronic
1049371187 8:142268167-142268189 CATGAAGCTCCATCATCCAGTGG - Intronic
1049474320 8:142789702-142789724 CAGGCAGCTCCTCCAGCCCGCGG - Intergenic
1049657264 8:143804419-143804441 CCTGCAGCTCCTTGAGGCTGGGG - Intronic
1050309496 9:4338722-4338744 CTTGCAGCTCCTTCTCCCATGGG - Intronic
1052320801 9:27165361-27165383 CATGCAGCTCTTGCTCTCTGTGG - Intronic
1052591202 9:30497862-30497884 CATGCTGCTGCAGCACCCTGCGG - Intergenic
1052684741 9:31740743-31740765 AATTCAGCTTCTTCTCCCTGAGG - Intergenic
1052790298 9:32869412-32869434 CAGGTGGCTCCTTCATCCTGTGG - Intergenic
1053672090 9:40376464-40376486 AGTGCAGCTGCTTCACCCTCTGG - Intergenic
1053921906 9:43002822-43002844 AGTGCAGCTGCTTCACCCTCTGG - Intergenic
1054383206 9:64516508-64516530 AGTGCAGCTGCTTCACCCTCTGG - Intergenic
1054512533 9:65999846-65999868 AGTGCAGCTGCTTCACCCTCTGG + Intergenic
1055850881 9:80628514-80628536 CATTGAGCTTCTTCACCCTTTGG - Intergenic
1057076395 9:92140425-92140447 CCTGCAGCTCGGCCACCCTGAGG - Intergenic
1058082993 9:100718878-100718900 CATGCAGCTCCATAGCCATGAGG + Intergenic
1060621391 9:125070316-125070338 CATGAAGATGCTTCACACTGTGG - Intronic
1062364966 9:136204090-136204112 CCTGCAGGTCCCTCTCCCTGTGG + Intronic
1062610910 9:137373045-137373067 CCTGCAGCTGCTTCAGCCTCAGG + Exonic
1203772255 EBV:55492-55514 CTTGCCGGTCCTTGACCCTGAGG - Intergenic
1185509154 X:649945-649967 CATCCAATTCCTTCTCCCTGTGG - Intronic
1187015420 X:15322706-15322728 CATCGAGCTCTTTTACCCTGAGG + Intronic
1187084478 X:16027864-16027886 CAAGAAGCTGCTTCTCCCTGGGG - Intergenic
1187465520 X:19523806-19523828 CATTCAGGTCTTTCACCCTAAGG + Intergenic
1187623259 X:21082519-21082541 CAAGCACCTCCTTCACAATGTGG + Intergenic
1189046928 X:37603283-37603305 AATTCAGCTCATTCACTCTGAGG - Intronic
1190340509 X:49292151-49292173 CCTGGAGCTCATGCACCCTGAGG - Intronic
1190701050 X:52990116-52990138 CCTGGAGCTCATGCACCCTGAGG + Intronic
1190909246 X:54757061-54757083 CAGTCTGCTCCTTCTCCCTGAGG - Exonic
1191742063 X:64446832-64446854 AATACAGCTGCTTCACCCTCTGG - Intergenic
1194205046 X:91002587-91002609 CATGCACTTCCTTCCCTCTGAGG - Intergenic
1194380299 X:93181909-93181931 CATGCACTTCCTTCCCTCTGAGG + Intergenic
1195732645 X:107981845-107981867 CTTGCAGCCACTGCACCCTGCGG + Exonic
1195786282 X:108527495-108527517 CATGCATCTCTTTCATACTGTGG - Intronic
1196951406 X:120879000-120879022 CATTCAGCTACTCCACCCTCAGG + Intronic
1196951548 X:120930489-120930511 CATTCAGCTACTCCACCCTCAGG + Intronic
1196952232 X:120935350-120935372 CATTCAGCTACTCCACCCTCAGG + Intronic
1196952917 X:120940211-120940233 CATTCAGCTACTCCACCCTCAGG + Intronic
1196953602 X:120945071-120945093 CATTCAGCTACTCCACCCTCAGG + Intronic
1196954287 X:120949932-120949954 CATTCAGCTACTCCACCCTCAGG + Intronic
1196954970 X:120954792-120954814 CATTCAGCTACTCCACCCTCAGG + Intronic
1196955659 X:120959675-120959697 CATTCAGCTACTCCACCCTCAGG + Intronic
1196956340 X:120964536-120964558 CATTCAGCTACTCCACCCTCAGG + Intronic
1196957022 X:120969396-120969418 CATTCAGCTACTCCACCCTCAGG + Intronic
1196957704 X:120974256-120974278 CATTCAGCTACTCCACCCTCAGG + Intronic
1196958386 X:120979116-120979138 CATTCAGCTACTCCACCCTCAGG + Intronic
1196959067 X:120983976-120983998 CATTCAGCTACTCCACCCTCAGG + Intronic
1197938058 X:131761047-131761069 CAAGAAGCTGCTTCTCCCTGGGG - Intergenic
1197939680 X:131776823-131776845 CAAGAAGCTGCTTCTCCCTGTGG - Intergenic
1198030932 X:132752760-132752782 CTGGCAGCTTCTTCGCCCTGAGG + Intronic
1200550872 Y:4577730-4577752 CATGCACTTCCTTCCCTCTGAGG - Intergenic
1200691173 Y:6307099-6307121 CCTGCAGCTCATGAACCCTGAGG + Intergenic
1201044099 Y:9867617-9867639 CCTGCAGCTCATGAACCCTGAGG - Intergenic
1202115355 Y:21466108-21466130 CCTGCAGCTCATGAACCCTGAGG - Intergenic