ID: 1049107827

View in Genome Browser
Species Human (GRCh38)
Location 8:140624674-140624696
Sequence GGCACCGTGTGCTCCCCGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049107824_1049107827 -1 Left 1049107824 8:140624652-140624674 CCAGTGAGCAACGGGCAACTCTG No data
Right 1049107827 8:140624674-140624696 GGCACCGTGTGCTCCCCGGCTGG No data
1049107819_1049107827 21 Left 1049107819 8:140624630-140624652 CCACCAACTGCGAACATCCACAC No data
Right 1049107827 8:140624674-140624696 GGCACCGTGTGCTCCCCGGCTGG No data
1049107823_1049107827 4 Left 1049107823 8:140624647-140624669 CCACACCAGTGAGCAACGGGCAA No data
Right 1049107827 8:140624674-140624696 GGCACCGTGTGCTCCCCGGCTGG No data
1049107818_1049107827 27 Left 1049107818 8:140624624-140624646 CCGAGGCCACCAACTGCGAACAT No data
Right 1049107827 8:140624674-140624696 GGCACCGTGTGCTCCCCGGCTGG No data
1049107820_1049107827 18 Left 1049107820 8:140624633-140624655 CCAACTGCGAACATCCACACCAG No data
Right 1049107827 8:140624674-140624696 GGCACCGTGTGCTCCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049107827 Original CRISPR GGCACCGTGTGCTCCCCGGC TGG Intronic