ID: 1049108086

View in Genome Browser
Species Human (GRCh38)
Location 8:140625994-140626016
Sequence GGGCCTTGCTGGGCGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049108086_1049108092 -1 Left 1049108086 8:140625994-140626016 CCAAGGTGCGCCCAGCAAGGCCC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1049108092 8:140626016-140626038 CCCCTGCCCCAGTCACCAATAGG No data
1049108086_1049108102 29 Left 1049108086 8:140625994-140626016 CCAAGGTGCGCCCAGCAAGGCCC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1049108102 8:140626046-140626068 GAGCCACCACGGCAAAGCCATGG No data
1049108086_1049108094 0 Left 1049108086 8:140625994-140626016 CCAAGGTGCGCCCAGCAAGGCCC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1049108094 8:140626017-140626039 CCCTGCCCCAGTCACCAATAGGG No data
1049108086_1049108100 18 Left 1049108086 8:140625994-140626016 CCAAGGTGCGCCCAGCAAGGCCC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1049108100 8:140626035-140626057 TAGGGCCACTCGAGCCACCACGG No data
1049108086_1049108103 30 Left 1049108086 8:140625994-140626016 CCAAGGTGCGCCCAGCAAGGCCC 0: 1
1: 0
2: 0
3: 20
4: 208
Right 1049108103 8:140626047-140626069 AGCCACCACGGCAAAGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049108086 Original CRISPR GGGCCTTGCTGGGCGCACCT TGG (reversed) Intronic
900012883 1:131723-131745 GGCCCTGGCGGGGCGCACCAGGG + Intergenic
900042948 1:487710-487732 GGCCCTGGCGGGGCGCACCAGGG + Intergenic
900064385 1:722707-722729 GGCCCTGGCGGGGCGCACCAGGG + Intergenic
900125623 1:1067829-1067851 CAGCCTTGCTGGCAGCACCTCGG - Intergenic
900350335 1:2231414-2231436 GGGCTTTGCTGGGGGCCCATTGG + Intronic
900693384 1:3995238-3995260 GCACCTTGCTGTGGGCACCTGGG + Intergenic
901800702 1:11706462-11706484 GGGCCTGGCTGGGCAGGCCTGGG - Exonic
902816957 1:18922058-18922080 GGGCCTTGCTTTCTGCACCTGGG - Intronic
903294005 1:22332241-22332263 GGGCCTGGCTGGGGGCCCTTGGG - Intergenic
903669390 1:25026505-25026527 GGGCTTTCCTGGGGGCAGCTTGG - Intergenic
904261378 1:29289624-29289646 CGGCCTTGGTGGACGGACCTCGG + Intronic
904293109 1:29500264-29500286 CGGCCTTGGTGGACGGACCTCGG - Intergenic
905279688 1:36841224-36841246 GGGCCTGGCTGGAAGCACCAGGG - Intronic
906137875 1:43512947-43512969 GGGCCTTGCTGGGCCTTCCATGG - Intergenic
911048825 1:93652126-93652148 AGGCCTTGCTGGGTTCACCTGGG - Intronic
914667362 1:149842270-149842292 GGGCCGGGCTGGGCCCACTTGGG + Exonic
914668405 1:149851520-149851542 GGGCCGGGCTGGGCCCACTTGGG - Exonic
914804518 1:150982716-150982738 GGGCCTGGCTGGGGTCTCCTGGG - Intronic
920214254 1:204350924-204350946 GGGCTGTGCTGGGGGCATCTGGG + Intronic
922099284 1:222468718-222468740 GGCCCTGGCAGGGCGCACCAGGG + Intergenic
922261323 1:223948213-223948235 GGCCCTGGCAGGGCGCACCAGGG + Intergenic
922324699 1:224517214-224517236 GGGCAGTGCTGAGCACACCTTGG + Intronic
922735752 1:227977527-227977549 GGCCCTGGCAGGGCGCACCAGGG - Intergenic
922932784 1:229403329-229403351 GGGCCATGCTGAGGGCACGTGGG - Intergenic
924188177 1:241519136-241519158 GGGCCTTGCTGGCCGGACACTGG - Intronic
924342483 1:243050393-243050415 GGCCCTGGCAGGGCGCACCAGGG + Intergenic
924629479 1:245723712-245723734 AGGCCTTGCTGGGTGCACAAGGG - Intergenic
1063692058 10:8296588-8296610 AGGCCCTGCTGGGTGCCCCTCGG - Intergenic
1065188729 10:23192417-23192439 GGCCCTGGCTGGGGGCAGCTAGG - Exonic
1065918067 10:30368616-30368638 GGGCCCTGCTGGGGGCTCCAGGG + Intronic
1068953727 10:62804176-62804198 GGGCCCAGCTGGGCCCAGCTGGG + Intergenic
1070368415 10:75758218-75758240 GGGGCTTGCTGCCCCCACCTGGG + Intronic
1071673592 10:87634760-87634782 GTGCCTTGCTGGGGGCTCTTGGG - Intergenic
1073133316 10:101204899-101204921 TGGAATTGCTGGGCCCACCTAGG - Intergenic
1075072566 10:119328470-119328492 GGTACTTGCTGGGCACACATGGG - Intronic
1075581970 10:123625677-123625699 TGGCCTGGCTGGGTGCAGCTGGG - Intergenic
1076096328 10:127737171-127737193 GGGCCGGGCTGGTCGCACCCGGG + Intergenic
1076604969 10:131683501-131683523 GCGCCTTGCCGGGGGCCCCTGGG + Intergenic
1076969220 11:123927-123949 GGCCCTGGCGGGGCGCACCAGGG + Intergenic
1077104549 11:836520-836542 GTGCCTTGCTGTGCTCACCTGGG + Intronic
1078548624 11:12264550-12264572 GGGCGTAGCTGGGCGTAGCTGGG + Intergenic
1078762121 11:14259819-14259841 GGTCCTTGCTGGGCACTGCTGGG + Intronic
1080614707 11:33935814-33935836 GGGCCTGGCTGGGCACAGCTCGG + Intergenic
1081753463 11:45528420-45528442 GGTCCTTTCTGAGCTCACCTAGG - Intergenic
1081995585 11:47361538-47361560 GGGACTTCCTGGGCGCAATTCGG + Intronic
1083310622 11:61781787-61781809 GGGCCCTGCTGAGCCCACCTGGG + Exonic
1083770609 11:64864858-64864880 GGGCCTTGCTGGGTGGAGTTTGG - Intronic
1084524070 11:69685034-69685056 GGGCATAGCTGGGGGCACCAAGG - Intergenic
1085510185 11:77084227-77084249 GTGCTTGGCTGGGCCCACCTGGG + Intronic
1085519637 11:77130512-77130534 GAGCCTGGCTGGGGTCACCTGGG - Intronic
1085711000 11:78829173-78829195 GGGCCCTGCTGGCCACACGTGGG - Intronic
1085982831 11:81744865-81744887 GGGCGGCGCTGGGCGCTCCTGGG - Intergenic
1089200391 11:116721151-116721173 GGACCTTGCAGGGCACACCGCGG - Intergenic
1090206355 11:124886675-124886697 GAGTCTTGCTGTGCCCACCTCGG - Exonic
1090699955 11:129285089-129285111 GGGAATTGCTGGGAGCACCCTGG - Intergenic
1091648295 12:2290330-2290352 GGGCCTCCCTGGGCTCAGCTGGG + Intronic
1094682649 12:32679590-32679612 GGGCCTTGCTGGGGGCCCCAGGG + Intronic
1100483621 12:95003702-95003724 GGGTTTTGCTCGGCGCACCCGGG - Exonic
1102642438 12:114378936-114378958 GGTCCTTGCTGACTGCACCTTGG - Intronic
1102812674 12:115837960-115837982 GAGCCTTGCTGAGCCCTCCTGGG + Intergenic
1103653712 12:122453935-122453957 GGGCCCATCTGGGCCCACCTGGG - Intergenic
1104013337 12:124947294-124947316 GGGCCTGGCTGGGGGCCCCCAGG - Exonic
1105407068 13:20142028-20142050 TGGCCTTGCTGGCCCGACCTGGG + Exonic
1113565227 13:111315753-111315775 GGGCTTTGCTGGGGCCACCCAGG - Intergenic
1113797491 13:113066846-113066868 GGGCCGTGCGGGGCGCACCCAGG + Intronic
1114572298 14:23680391-23680413 GGGCCTTGCTGTGCCCACAGTGG + Intergenic
1114671419 14:24413370-24413392 GGGCCGTGATGGCCCCACCTTGG + Exonic
1114726614 14:24944440-24944462 GGGCTCTGCTGGGAGCACATAGG + Intronic
1115467525 14:33731924-33731946 GGGCAGAGCTGGGCGCAACTGGG + Intronic
1121664864 14:95664835-95664857 GGGCCTGGCTTGGCCCACCTTGG + Intergenic
1122269320 14:100561266-100561288 GGGCCTTGCTGCCCACCCCTTGG - Intronic
1122779192 14:104136494-104136516 GAGCCTTGCGGGGCGCGCCGCGG - Intergenic
1123114992 14:105890546-105890568 GGGCCTTCTTGGGGCCACCTCGG + Intergenic
1129206098 15:74037827-74037849 GGGCGTGGCTGAGAGCACCTGGG - Intronic
1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG + Intronic
1130438359 15:83925431-83925453 GGGCCTTGCTTTGCTCACCAAGG - Intronic
1132179663 15:99742704-99742726 TGGCCTTCCTGGGCATACCTGGG + Intergenic
1132606747 16:796857-796879 GAGCCTGGGTGGGCTCACCTGGG - Exonic
1132980685 16:2737427-2737449 GGGCCTGGCTGGGGGTCCCTAGG - Intergenic
1135486706 16:22871889-22871911 GGGCCAGGGTGGGCTCACCTGGG + Intronic
1139429018 16:66901162-66901184 GGGCCTCGAGGGGGGCACCTAGG + Intergenic
1140519131 16:75566695-75566717 GGGCCTTGCTGGGAGCTAGTAGG + Intronic
1140746695 16:77986887-77986909 GAGCCTTCCTGAGAGCACCTTGG - Intergenic
1141184702 16:81779189-81779211 GGACCCGGCTGGGCGCGCCTGGG + Intronic
1142120519 16:88384352-88384374 GGGCTGTGCTGGGGGCACCTAGG - Intergenic
1142219876 16:88848837-88848859 GGGCCGCTCTGGGCGCACGTGGG + Intronic
1142350106 16:89575860-89575882 GGGCCCGGCTGGGCGCACTGAGG - Exonic
1142451453 16:90175195-90175217 GGCCCTGGCGGGGCGCACCAGGG - Intergenic
1143034932 17:3989351-3989373 GCGCCTTGCTGGGCTGACTTGGG + Intergenic
1143378025 17:6478752-6478774 GATCCTGGCTGGGCTCACCTTGG - Intronic
1143880560 17:10026535-10026557 GGGCATGGCTGGGCACGCCTGGG + Intronic
1145031353 17:19507499-19507521 GGGCCTGGCTGGGGGCGGCTGGG - Intronic
1148446777 17:47742816-47742838 GGGGCTTGGTGGGCCCACCAGGG - Intronic
1148835010 17:50461378-50461400 GGGGCTTGCTTGGCACAGCTTGG + Intronic
1150305995 17:64085785-64085807 GGGCCTAGCTGGCCACACCATGG - Intronic
1151783435 17:76262882-76262904 GGGCCCAGCTGTGGGCACCTGGG - Intergenic
1151890417 17:76947975-76947997 GGGCCTGGCTGGCCGTGCCTGGG + Exonic
1152362583 17:79839496-79839518 GGGCCTCGCCGGGCCCAGCTCGG + Intergenic
1152812891 17:82390693-82390715 GGGACTTGGGGGCCGCACCTTGG - Intronic
1152833509 17:82513894-82513916 GGGCATGGCTGGGCGCGCCTGGG - Intergenic
1153822447 18:8843963-8843985 GGGCCTTGGTGGGGGTACCTGGG - Intergenic
1157712570 18:49860011-49860033 GGGCTTGGTCGGGCGCACCTGGG - Intronic
1160646026 19:193853-193875 GGCCCTGGCGGGGCGCACCAGGG + Intergenic
1160682013 19:416199-416221 GGGCCATGCTGGGGGCATCTTGG + Intergenic
1160824110 19:1071462-1071484 TGGCCTGGCCGTGCGCACCTGGG + Intronic
1160835153 19:1121532-1121554 CGGCCCTGCAGGGTGCACCTTGG - Intronic
1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG + Intronic
1161753823 19:6116919-6116941 GGACCTTGTTGGGCACAGCTTGG + Intronic
1162127120 19:8505781-8505803 GGGCCTTGGTGCGCGCGCCCTGG - Intergenic
1162811188 19:13165087-13165109 CTGCCTTGCTGGGCTTACCTAGG + Intergenic
1162911734 19:13851369-13851391 GGGCCTTTGTGGGAGCAGCTGGG - Intergenic
1163126373 19:15246411-15246433 GGGGCATGCTGGGCACACCTTGG + Intronic
1163614516 19:18318747-18318769 GGGCCTTGCTGGATGTCCCTGGG - Intronic
1163715254 19:18869373-18869395 AGGCCCGGGTGGGCGCACCTGGG + Exonic
1164156404 19:22600180-22600202 GGGCCTTGCTGGGGGTGCCAGGG - Intergenic
1165078691 19:33295332-33295354 GCGGCTTGCTTGGCGGACCTTGG + Intergenic
1165661820 19:37587492-37587514 GGGGCGTGCTGTGCGCACATTGG - Intronic
1166916093 19:46196909-46196931 AGCCCTTCCTGGGCTCACCTGGG - Intergenic
925829728 2:7882451-7882473 GGGCCATGCCTGGCCCACCTGGG + Intergenic
927012548 2:18920589-18920611 GTGCCTTGATGGGAGCACGTAGG - Intergenic
931802431 2:65771694-65771716 GGCCCCTGCAGGGCCCACCTAGG + Intergenic
932739695 2:74282216-74282238 GGGGCTTGCTGGTCATACCTTGG + Intronic
934113754 2:88765374-88765396 GGGGCTGGCGGGGCTCACCTGGG - Intergenic
934538943 2:95159169-95159191 GCGCCGCGCTGGGCGCACCGGGG - Intronic
935163594 2:100550171-100550193 TGGCCATGCTGGGGGCACCCTGG + Intergenic
940650570 2:156436394-156436416 GCGCCTCGCTGGGAGCACCCGGG + Intronic
948467258 2:238158509-238158531 GGGCCTTGCGGGGCGCAGCCAGG + Intergenic
948656052 2:239477147-239477169 GGGCCGTGTAGGGAGCACCTAGG + Intergenic
948748172 2:240110661-240110683 GGGGCTTGTTGGGAGAACCTTGG - Intergenic
948792287 2:240385356-240385378 AGGCTTGGCTGGGCTCACCTGGG + Intergenic
948792377 2:240385681-240385703 GGGCCATGCTGGGCTGAGCTGGG + Intergenic
949027947 2:241775068-241775090 GGGCCCTGCTGGGAGCCCCAGGG - Intergenic
1169193557 20:3671998-3672020 GGGCCAGGCTGGGGGCAGCTCGG + Intronic
1171430171 20:25078037-25078059 GGGCGCTGCTGGGGGCTCCTGGG - Intronic
1171456115 20:25273320-25273342 GGGTCTTGCTGGGAGTACCATGG + Intronic
1172306485 20:33884452-33884474 CTGCCTGGCTGGGAGCACCTGGG + Intergenic
1172875199 20:38159985-38160007 GAGACTTGCTGGGGGCTCCTTGG + Intronic
1173310714 20:41893872-41893894 GGGCCATACTGGGCCCACCCCGG - Intergenic
1175873634 20:62219669-62219691 CGGCCACGCTGGGCGCCCCTGGG + Intronic
1176061129 20:63173480-63173502 GGCCCCTGCTGGCCCCACCTAGG - Intergenic
1179140910 21:38724166-38724188 AGGCCTTGCTGGAAGCACCCTGG - Intergenic
1180060325 21:45381711-45381733 GGGCCTTGTTGGGCTCCTCTGGG - Intergenic
1180594666 22:16965338-16965360 GGGCCTTTCTAAGCACACCTGGG - Intronic
1181276181 22:21688624-21688646 GGGCCTTGCTGAGCCCAGCCTGG - Intronic
1181775937 22:25160334-25160356 GGGGCTGGATGGGCCCACCTGGG - Intronic
1182351195 22:29700920-29700942 GCGCCGTGATGGGAGCACCTGGG + Intergenic
1182424563 22:30265302-30265324 TGGCCTTGGTGGGCACACCTGGG - Intronic
1183395684 22:37569492-37569514 GGGCCTTGATGGGGGATCCTTGG - Intergenic
1184046874 22:41977306-41977328 GGGGCTTTCTGTGCGCATCTGGG - Intronic
1185045568 22:48527115-48527137 GGCCCTTGCTGGCCTCCCCTGGG + Intronic
1185080629 22:48707643-48707665 GGGTGTTGCTGAGGGCACCTGGG - Intronic
1185138917 22:49089450-49089472 GGGCTGTGCTGGGCCCACCCTGG - Intergenic
953717182 3:45325825-45325847 GGGCTTTCCTGGGATCACCTGGG - Intergenic
954426364 3:50445300-50445322 GAGCCTAGCTGGGCTCTCCTGGG - Intronic
955393125 3:58535621-58535643 GAGGATTGCTGGGGGCACCTTGG + Intronic
956748136 3:72325658-72325680 GGGGCTGGCTGGGCTCAGCTGGG + Intergenic
961637519 3:128342628-128342650 GTGCCTTGCTGGGCGGCCCTTGG + Intronic
963912836 3:150829549-150829571 GGGACTTGCTGGAAGCAGCTGGG + Intergenic
967174363 3:186849413-186849435 GGGCTTTGCTGGTCTCCCCTTGG + Intronic
968371655 3:198225673-198225695 GGCCCTGGCGGGGCGCACCAGGG - Intergenic
968508483 4:983523-983545 GGGCCTCGCTGGGCTCCCCCAGG + Intronic
968728926 4:2260842-2260864 GGTCCTGTCTGGGCCCACCTTGG - Intronic
969444569 4:7236966-7236988 GGGCTCTGCTGAGCCCACCTGGG + Intronic
969507797 4:7598923-7598945 GGGCCTTGCTGGCCACAGCCTGG + Intronic
974508361 4:62806696-62806718 GGGCATAGCTGGGCACAGCTTGG + Intergenic
975689290 4:76949170-76949192 GGGCCCTCCAGGCCGCACCTCGG - Intergenic
978861698 4:113457907-113457929 GGGCAGTGCTTGGCACACCTGGG - Intronic
979260342 4:118638151-118638173 GGCCCTGGCAGGGCGCACCAGGG - Intergenic
980170091 4:129278769-129278791 GGGCCTTGCTGGGCAGAACTGGG + Intergenic
981615613 4:146640265-146640287 GGGCCATGCTGAGCGCTGCTTGG - Exonic
982722030 4:158869199-158869221 GGGCCCCGCTGGACACACCTGGG - Exonic
984862833 4:184255492-184255514 AGGCCTGGCTGGGGGCAGCTGGG - Intergenic
989060067 5:37401666-37401688 TGGCCATGCTGGTCTCACCTGGG + Intronic
997232194 5:132253305-132253327 GGGCCTCTCTGGGCCCAGCTAGG + Intronic
998942924 5:147304548-147304570 GGGACTTGAAGGGAGCACCTTGG + Intronic
999442119 5:151610123-151610145 GGGCTTTGAGGGGCCCACCTGGG + Intergenic
999615312 5:153416806-153416828 GAGCCTTGGTGGGGGCAGCTTGG - Intergenic
1002730895 5:181331219-181331241 GGCCCTGGCGGGGCGCACCAGGG - Intergenic
1002753638 6:142885-142907 GGCCCTGGCGGGGCGCACCAGGG + Intergenic
1006361682 6:33590473-33590495 GGGCCTTGCAGGGCTTCCCTGGG + Intergenic
1006440258 6:34049476-34049498 GGGGCTGGCTGGGAGCACCAAGG - Intronic
1006501007 6:34458765-34458787 GGGCCTTGCTGGGCCTTGCTGGG - Intergenic
1008952043 6:57172252-57172274 GGGCCTCGCGGGGCGGAGCTGGG + Intergenic
1011513928 6:88131689-88131711 GGGCCCTACTGGGGGCTCCTGGG + Intergenic
1012829626 6:104188034-104188056 GGGCATTGCTGGGCTCACTGGGG + Intergenic
1013268110 6:108520259-108520281 GGGCCTTGCTAGGCACTCCATGG - Intronic
1013455374 6:110325119-110325141 GGGCCTAGCTGAGTGCTCCTGGG - Intronic
1015455725 6:133424536-133424558 GGTCCTTCCTGGGGGCACCGTGG + Intronic
1018651880 6:165999099-165999121 AGGGCTTCCTGGGCTCACCTGGG - Intergenic
1019350205 7:551020-551042 AGGCCTACCTGGGTGCACCTGGG - Intronic
1019503273 7:1376268-1376290 TGGCCTTTCTGGGGGCTCCTGGG + Intergenic
1019522278 7:1466364-1466386 GGGCCCTGCTGGGCTCACGGGGG - Intergenic
1019643396 7:2116490-2116512 GGGTCTTGCTGGGGACACCTCGG - Intronic
1020110274 7:5443892-5443914 GGGCCACGCTTGGCGCTCCTGGG - Intronic
1023271273 7:38465459-38465481 GGGCCTACCTGGGCGCTCCTTGG + Exonic
1024647562 7:51382908-51382930 GGCCCTGGCAGGGCGCACCAGGG + Intergenic
1024983662 7:55178084-55178106 GGGCCTCGCAGGGCTGACCTGGG - Intronic
1025051395 7:55737404-55737426 GGCCCTGGCAGGGCGCACCAGGG + Intergenic
1025115257 7:56252497-56252519 GGGCATTGCTGGGAGAGCCTAGG - Intergenic
1025176749 7:56805952-56805974 GGCCCTGGCAGGGCGCACCAGGG + Intergenic
1025695045 7:63770434-63770456 GGCCCTGGCAGGGCGCACCAGGG - Intergenic
1026199647 7:68203334-68203356 GGGCATTGCTGGGAGAGCCTGGG - Intergenic
1026371757 7:69706456-69706478 GAGACTTGCTGAGCACACCTAGG + Intronic
1026775626 7:73229516-73229538 GGGCATTGCAGGGCCCATCTGGG - Intergenic
1027016485 7:74782888-74782910 GGGCATTGCAGGGCCCATCTGGG - Intronic
1027071544 7:75163048-75163070 GGGCATTGCAGGGCCCATCTGGG + Intergenic
1029187937 7:98752973-98752995 GGGAGATGCTGGGCGCACCTAGG - Intergenic
1029250460 7:99232713-99232735 GGGCCTGACTGGGCACTCCTGGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1032052571 7:128658144-128658166 GGCCCTGGCAGGGCGCACCAGGG - Intergenic
1034451261 7:151138434-151138456 GGGCCCAGCTGGGCCCTCCTGGG + Intronic
1036206215 8:6807314-6807336 GGGCTTTGCTGGGTGAATCTGGG - Intergenic
1037706959 8:21323380-21323402 GGACATTGCTGGCCACACCTAGG + Intergenic
1044124286 8:88438228-88438250 GGGCTTTTCTGGGCCCACCCTGG + Intergenic
1049108086 8:140625994-140626016 GGGCCTTGCTGGGCGCACCTTGG - Intronic
1049606999 8:143534422-143534444 GGGCCTTGCTCGGCGCCCCCCGG - Intronic
1053152104 9:35749668-35749690 GGGCGTTGCGGTGAGCACCTAGG - Intronic
1058429602 9:104906511-104906533 TGGCTTTGCTGGGCACACTTAGG + Intronic
1061304170 9:129722992-129723014 GAGCCTTGCTGTGTGAACCTGGG + Intergenic
1062036677 9:134385585-134385607 GGCCCTTGCTGGGAGCAGGTGGG + Intronic
1062360972 9:136187899-136187921 GGGCCATGTTGGCAGCACCTGGG - Intergenic
1062637724 9:137500354-137500376 GGGCCTTGCTGAGCCAAGCTGGG + Intronic
1062755301 9:138283726-138283748 GGCCCTGGCGGGGCGCACCAGGG - Intergenic
1203579213 Un_KI270745v1:27898-27920 GGCCCTGGCGGGGCGCACCAGGG - Intergenic
1186366456 X:8899618-8899640 GGGTCTTGCTGTGCTCACCCAGG + Intergenic
1188922325 X:35992283-35992305 GGGCCATGATGGTAGCACCTGGG + Intergenic
1189564634 X:42228681-42228703 GAACCCTGCTGGGCGCACATTGG + Intergenic
1193109586 X:77714318-77714340 GGGCCTTGCTGGACCCTTCTCGG - Intronic
1194053406 X:89100783-89100805 GGGGCTTGCTGTGCCCACCGTGG + Intergenic