ID: 1049119644

View in Genome Browser
Species Human (GRCh38)
Location 8:140723078-140723100
Sequence GTGTGTAGGTAGAAATATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049119644 Original CRISPR GTGTGTAGGTAGAAATATCA GGG (reversed) Intronic
909896465 1:81077014-81077036 GTGAGTAGATAGAAAAATGATGG - Intergenic
914320908 1:146558668-146558690 GTGTGTAGATAGAAACTTGAAGG + Intergenic
918550853 1:185740579-185740601 GTGTTTAGGTAGATCTCTCATGG + Intronic
918905674 1:190489645-190489667 GAGTGTAGATATAAATATAAAGG - Intergenic
919031374 1:192247450-192247472 ATGTGTATGTATAAATATCCAGG - Intergenic
920716984 1:208349595-208349617 GTGTGCAGGTAGCATTTTCATGG + Intergenic
921967637 1:221107538-221107560 GTATGTGTGTAGAAATTTCAAGG - Intergenic
923113532 1:230913136-230913158 GTGTGTAGGAAGAAAGTTCAGGG + Intronic
924036771 1:239945739-239945761 GTGGGGAGGTAGAGATTTCAGGG - Intergenic
1063049213 10:2427696-2427718 CTCTGTATGTAGAAATCTCAAGG + Intergenic
1065630941 10:27680386-27680408 GTGTGTAGTTAGGAAAATCTTGG + Intronic
1065666385 10:28066700-28066722 GTGTGCTGTTAGAAATCTCAAGG - Intronic
1066693692 10:38059258-38059280 GTGTCTAGTTGGAAACATCAAGG - Exonic
1070558400 10:77547357-77547379 GTGGGTAGGTTGAAATATAACGG - Intronic
1072432794 10:95388353-95388375 GTATGCAGTTAGAAATACCAAGG + Intronic
1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG + Intronic
1073937953 10:108657523-108657545 CTGTGTATGTAGAAATTTTATGG + Intergenic
1074095328 10:110306375-110306397 GTGTGTAGCTAGAATTAAGAAGG + Intergenic
1074711041 10:116177768-116177790 GTCAGTAGGGAGAAATAGCAGGG - Intronic
1075956561 10:126528372-126528394 GTGTGTGGGAAGAAAGAGCAAGG + Intronic
1076447638 10:130528472-130528494 GCATGTAGGGAGAAAAATCACGG - Intergenic
1079247549 11:18763921-18763943 GTGTGGAGGAAGAAAGAGCATGG - Intronic
1079537273 11:21529229-21529251 GTGAGCAGGTAGAAATATTCTGG + Intronic
1081212630 11:40355094-40355116 GTGTGTATTTAGAAATGTCCAGG + Intronic
1086151789 11:83619658-83619680 TTGTGGAGGTGGAAGTATCATGG + Intronic
1088987676 11:114924480-114924502 GGGTGTAGCCATAAATATCAGGG - Intergenic
1094276254 12:28679147-28679169 GTGTCTAGGAAGAAAATTCAAGG + Intergenic
1098154772 12:67586614-67586636 ATGTTTCTGTAGAAATATCAGGG + Intergenic
1099077265 12:78125578-78125600 GTTTCTAGGCAGAAATGTCAAGG - Intronic
1103502740 12:121416284-121416306 GTGGGTAGGTGGAAAACTCAGGG - Exonic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1108983798 13:56556942-56556964 ATGAATAGGAAGAAATATCAAGG + Intergenic
1110809280 13:79793456-79793478 GTGTTTAGGTGGAACTATCCAGG + Intergenic
1111213846 13:85117448-85117470 GTGTGTAGGAAGAAAAAACTGGG - Intergenic
1111260952 13:85739090-85739112 GTGTGTAGGAGGCAATACCATGG + Intergenic
1111481681 13:88836127-88836149 GTGTGTACATTGGAATATCAAGG - Intergenic
1111662267 13:91225937-91225959 GTGTGAAGGTAAAAATTTCAGGG - Intergenic
1113323272 13:109258267-109258289 GTGGGTTTGTAGAAATGTCAGGG + Intergenic
1114242805 14:20884338-20884360 GTGTGTAGGAAAAAATGTAAAGG + Intergenic
1114249735 14:20948277-20948299 GTGTGTAGGAAAAAATGTAAAGG + Intergenic
1115836640 14:37413175-37413197 GTGTGTAGTTACAACTCTCAAGG + Intronic
1116220697 14:42083880-42083902 ATCTGAAGGTACAAATATCACGG - Intergenic
1117535155 14:56696227-56696249 GTGTGTTGGGGGAAATATCCAGG - Intronic
1117725588 14:58669708-58669730 ATTTGGAGGTAGAAATATGATGG + Intergenic
1117839906 14:59849385-59849407 GTGTTTAGATAGCAATATCAGGG - Intronic
1119859860 14:77928275-77928297 TTGTGAAGGTAGAGATGTCATGG + Intronic
1119948757 14:78722839-78722861 GAGTGTGGGGAGAAATATCATGG + Intronic
1120125048 14:80731954-80731976 GTGTGTAGTTAGAAATTATAGGG + Intronic
1121425766 14:93850826-93850848 ATCTGTAGGTACAGATATCAGGG - Intergenic
1122818275 14:104326111-104326133 GTGTGTATGGAGGAATCTCAAGG + Intergenic
1124555244 15:30719268-30719290 GTGTGTGGATGGAAATATCAGGG + Intronic
1124676011 15:31686413-31686435 GTGTGTGGATGGAAATATCAGGG - Intronic
1124984641 15:34595041-34595063 GTGTGTAGGTAGAAGTGGCTGGG + Intergenic
1126410756 15:48370703-48370725 GTGGGGAGGTAGAATTACCAGGG + Intergenic
1127104966 15:55604069-55604091 GTCTGTAGGTAGAATTACAAGGG - Intergenic
1131591405 15:93752830-93752852 GGGTGTAGAAAGATATATCATGG + Intergenic
1133403549 16:5505871-5505893 GTTTGCTGGTAGAAATGTCATGG - Intergenic
1137534715 16:49311152-49311174 GTGTGATGGTAGAGTTATCAGGG + Intergenic
1138401190 16:56745554-56745576 GTGTCTAGGTAGAGATGGCAAGG + Intronic
1140012625 16:71151439-71151461 GTGTGTAGATAGAAACTTGAAGG - Intronic
1140507059 16:75480126-75480148 GTGGGTAGGTAGAACTAAGAAGG - Intronic
1141852721 16:86658468-86658490 GTGGGCAGGTAGAAAGATGAAGG - Intergenic
1144066578 17:11629778-11629800 TTGTGTTGGGAGAAAGATCAAGG + Intronic
1148399763 17:47346663-47346685 GTTTGTAGGTAAGAATATCAAGG - Intronic
1149198803 17:54157798-54157820 GTGTGGAAGTAGAAAAATGAAGG + Intergenic
1149458097 17:56805504-56805526 GTTTTAAGGTAGAGATATCATGG - Intronic
1149778771 17:59379472-59379494 GTGTGTAGGTAGAGATACAAAGG - Intronic
1150072298 17:62162140-62162162 GTGTGTGGGTAGAAGTAGCCTGG - Intergenic
1151245041 17:72787924-72787946 TGTTGTAGGTAGATATATCAGGG + Intronic
1153168024 18:2284155-2284177 GTGTGTGTGTGGAAATATCAGGG - Intergenic
1155018378 18:21870874-21870896 CTGTATAGTTAGAAATTTCATGG + Exonic
1156907309 18:42369518-42369540 GTGTGGAGGTAGAAATTGTAGGG + Intergenic
1157867884 18:51201833-51201855 CTGGGTAGGAAGAAATATCGTGG - Intronic
1158560326 18:58507949-58507971 GTGGGGAGGTAGGAATATCATGG - Intronic
1159778892 18:72638058-72638080 TTATGCAGGTAGAAATAGCAGGG - Intronic
1163085745 19:14978885-14978907 GTGTGTAGGTAGGAATTGTATGG - Intronic
1164882635 19:31747208-31747230 GTGTGTATGTAGATATATATAGG + Intergenic
925356253 2:3243717-3243739 GTGTGTAGGCAGAAAAACAACGG + Intronic
926226412 2:10970281-10970303 GTGTTTAGCTACAAACATCACGG + Intergenic
927489159 2:23509221-23509243 GTGTGGAGGCAGAAATAACCCGG - Intronic
928078979 2:28291864-28291886 GTGTGTAGGTAGTAAGATCGTGG + Intronic
928869749 2:35962212-35962234 GGGAGCAGGTAGAAATCTCATGG + Intergenic
928967892 2:36995382-36995404 GTGTATAGATAGGAATAACAAGG - Intronic
929755419 2:44760267-44760289 GTGTGGAGTAAGAAAAATCATGG + Intronic
931009563 2:57893838-57893860 GTGTGTGGGTATAAACAACAGGG + Intergenic
933385490 2:81605738-81605760 GTGTCTAGGTAGAAGAGTCATGG - Intergenic
935678439 2:105616415-105616437 GTATGAAGGTAGAGTTATCAGGG - Intergenic
939509238 2:143086371-143086393 GTGAGGAGGTAAAAATATCACGG + Intergenic
941499499 2:166252754-166252776 GTGTGTATGTGTAAACATCATGG - Intronic
942899764 2:181100603-181100625 TTTTGTAGGTAAAAATATCTGGG - Intergenic
944979174 2:205094271-205094293 TTGTGTAGGAAGATATATGAAGG + Intronic
945195224 2:207231325-207231347 GGCTGTAGGCAGAAATTTCAAGG - Intergenic
947314508 2:228841142-228841164 TTATGTAGGTAGAAATCTCAGGG - Intergenic
947382543 2:229559212-229559234 ATGGGTAGTTAGAAACATCATGG + Intronic
1168867074 20:1095955-1095977 GTGTCTAGGAAGGAAGATCAGGG - Intergenic
1169027031 20:2380179-2380201 GTTTGTAGGTAGAAACACCAGGG + Intergenic
1174034068 20:47655711-47655733 GTGTGTGGGGAGAAATAGAATGG + Intronic
1176726292 21:10437132-10437154 GAGTTTAGGTGGAAATATGAAGG - Intergenic
1180288085 22:10769975-10769997 GAGTTTAGGTGGAAATATGAAGG + Intergenic
1182116275 22:27758254-27758276 GTGTGGAGGTGGAAGGATCAGGG - Intronic
954989081 3:54823226-54823248 GTGTGTAAGGGGAAAAATCAGGG + Intronic
964939674 3:162142141-162142163 GAGTTTAGGAAGAAATATTAAGG + Intergenic
965328598 3:167340119-167340141 ATGTGTAAATAGAAATATCCTGG - Intronic
965614454 3:170578962-170578984 GTCAGCAGGTAGAAATTTCAGGG - Intronic
967210164 3:187161426-187161448 GTGTGTAGGTAGAGAGTTAAGGG + Intronic
972442395 4:39107376-39107398 GTGGGTGGGTTGAAATAGCACGG - Intronic
973113205 4:46421218-46421240 ATCTGTTGTTAGAAATATCAAGG - Intronic
973264461 4:48197791-48197813 GTGTGGAACTAGAACTATCAAGG - Intronic
973934708 4:55832003-55832025 TTGTGGAGGTAGAAAGTTCAAGG - Intergenic
975397397 4:73892859-73892881 CTCTGTAGGTAGATATATCATGG - Intergenic
977102627 4:92836621-92836643 GTAAGGAGGCAGAAATATCAAGG + Intronic
981469841 4:145120042-145120064 ATGTGTATGTATAAATATCCAGG + Exonic
982886831 4:160792029-160792051 GGGTGGAGGGAGAAATAACAAGG - Intergenic
984716276 4:182928462-182928484 GTATGTAGGTAGCAATGTCAGGG - Intergenic
986580095 5:9256799-9256821 GTCTGAAGGTAGGAATTTCAAGG + Intronic
988371607 5:30376711-30376733 TTGTGAAGGAAGAAATATGATGG - Intergenic
990686157 5:58303427-58303449 ATATGTAGATAAAAATATCATGG - Intergenic
990968455 5:61476330-61476352 GTGTGTAGATAAAGAAATCAAGG + Intronic
995511220 5:112911246-112911268 GTCTGGAGGTTGAAATTTCAAGG - Intronic
996137111 5:119856665-119856687 GTGTGTGTGTATACATATCATGG + Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004278755 6:14260848-14260870 GTGTTTAGGGAGAAACATAAAGG + Intergenic
1004469437 6:15916212-15916234 GTGTGTAACAAGAAAGATCAAGG - Intergenic
1005757484 6:28938140-28938162 GAGTGTAGGCATAAATATAAAGG - Intergenic
1011977282 6:93319074-93319096 GCGTTTAGGAAGTAATATCAAGG + Intronic
1012270315 6:97201654-97201676 GTGTGTGGGAAGCAATATCTAGG + Intronic
1014652365 6:124055467-124055489 GTGTGTAATTAGAAAAAACAAGG - Intronic
1016692396 6:146953252-146953274 GTGAGTAGGTTTAAATATCAGGG + Intergenic
1016807346 6:148225018-148225040 GTGAGTAGGAAGAAATATTATGG + Intergenic
1017044428 6:150334063-150334085 GTGTGCAGGGAGGGATATCAAGG - Intergenic
1022546026 7:31189998-31190020 ATGTTTGGGTAGAAATATTAAGG - Intergenic
1022755372 7:33282299-33282321 GTGTGTAGAGAAAAATATCAGGG - Intronic
1027748608 7:82111251-82111273 GTGTGTATATATATATATCAAGG - Intronic
1028441588 7:90869287-90869309 GTGTTTAGGTAAAAATCTGAAGG + Intronic
1030462615 7:109859556-109859578 ATGTCTCTGTAGAAATATCAGGG + Intergenic
1031298070 7:120029607-120029629 GTCTTTAAGTAGATATATCATGG + Intergenic
1034603815 7:152290932-152290954 GAGTTCAGGTAGAAATATGAAGG + Intronic
1041000777 8:53449938-53449960 GTGTGTAGGCATAAATGTAAGGG - Intergenic
1041831431 8:62159251-62159273 GGATGCTGGTAGAAATATCATGG - Intergenic
1043066884 8:75583902-75583924 GTGTGGAAGTAGGAATATAAGGG + Intergenic
1044200932 8:89435473-89435495 GTGTGTATTTTGAAATATGAAGG - Intergenic
1045095463 8:98792959-98792981 GTGTGTATGTATATATATGATGG + Intronic
1046243594 8:111531026-111531048 TTGTGTAGCTAGAAATACTAAGG - Intergenic
1046403473 8:113739749-113739771 GTGTGTATATATATATATCAAGG - Intergenic
1048392726 8:133983554-133983576 GTAAGTAGGTAGAATTATGAAGG + Intergenic
1049119644 8:140723078-140723100 GTGTGTAGGTAGAAATATCAGGG - Intronic
1050056266 9:1658896-1658918 ATCTGGAGGTTGAAATATCAAGG + Intergenic
1052633919 9:31075523-31075545 GAGTGTAGGTAGAGACAGCAAGG - Intergenic
1054355262 9:64055092-64055114 GTGTGTAGAAAGAAAAATCAAGG - Intergenic
1055027033 9:71733097-71733119 GTGTGTAGATATTAATATCAGGG + Intronic
1056690234 9:88802000-88802022 GTTTATAGGGAGAAATATAATGG + Intergenic
1058738352 9:107917736-107917758 GTGAGTGGGTGGAAATTTCAAGG + Intergenic
1187773170 X:22725258-22725280 GTGTGTAGTAAGCTATATCATGG + Intergenic
1188842357 X:35031854-35031876 GTGGGGAGGGAGAAATAACAGGG + Intergenic
1191661281 X:63653992-63654014 GTGTCTAATTAGAAAAATCAAGG - Intronic
1191955873 X:66641964-66641986 GAGTGTTGGAAAAAATATCAAGG - Intergenic
1192218786 X:69182591-69182613 GTGTTTAGGAAGAAATAGGAGGG + Intergenic
1193097170 X:77563731-77563753 GTGTGTGTGTAGACATATTACGG + Intronic
1195400271 X:104453907-104453929 GGGTGCAGGTAGGCATATCATGG - Intergenic
1196529552 X:116769153-116769175 GGGTGTGGGTACAAATATAAAGG + Intergenic
1197637765 X:128934509-128934531 GTGTATATGTCAAAATATCATGG + Intergenic
1198605106 X:138329133-138329155 GTGTGAAGGTAGAGATATATGGG - Intergenic
1198873893 X:141202889-141202911 CTGTATAGGTAGAAAGATGAGGG - Intergenic