ID: 1049122846

View in Genome Browser
Species Human (GRCh38)
Location 8:140755417-140755439
Sequence CGGTGTGGCCGCGGAGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049122846_1049122860 26 Left 1049122846 8:140755417-140755439 CCCTCTACTCCGCGGCCACACCG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data
1049122846_1049122855 14 Left 1049122846 8:140755417-140755439 CCCTCTACTCCGCGGCCACACCG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049122846 Original CRISPR CGGTGTGGCCGCGGAGTAGA GGG (reversed) Intronic
900796660 1:4712296-4712318 CGGTGGGGCCCCGGAGCAGCAGG + Exonic
902990693 1:20185560-20185582 CAGTGTGGCCCCGGAGTGGGAGG + Intergenic
903999572 1:27331183-27331205 GGGTGTGGCCATGGAGAAGAGGG + Intronic
904532302 1:31177128-31177150 CGGGGTGGCCGCCGGGCAGAGGG - Intergenic
904760924 1:32804267-32804289 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
906356902 1:45115172-45115194 CGGGGTGGCCGCCGGGCAGAGGG + Intronic
912594040 1:110856395-110856417 CACTGTGGCAGCGGAGGAGATGG - Intergenic
913543681 1:119845725-119845747 CAGTGTTGCTGCGCAGTAGAAGG + Intergenic
914908917 1:151769191-151769213 CGGTGTGGCGGCCGGGCAGAGGG + Intronic
916037437 1:160933620-160933642 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
916671958 1:167029765-167029787 CGGGGTGGCTGCCGGGTAGAGGG - Intergenic
918034236 1:180851352-180851374 GGGTGTGGTGGAGGAGTAGAGGG + Intronic
918659949 1:187075210-187075232 AGGTGTGGTCATGGAGTAGAAGG - Intergenic
920065483 1:203266657-203266679 CGGGGTGGCAGCTGAGCAGAGGG + Intronic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1065809256 10:29426430-29426452 TGGTGTGACCCTGGAGTAGATGG + Intergenic
1081864697 11:46353032-46353054 CTCTGTGGCCGCGGAGGGGAGGG + Intronic
1084447118 11:69210096-69210118 GGGTGTGCCCGCGGAGTCGCAGG + Intergenic
1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG + Intronic
1087158952 11:94930529-94930551 AGGTGTGGCCATGGAGTAAAGGG + Intergenic
1096167591 12:49437112-49437134 CGGTGTGGCTGCCGGGTGGAGGG + Intronic
1097178921 12:57159841-57159863 GGGTGTGGCCGTGGACTGGATGG + Exonic
1102301956 12:111777648-111777670 CGGGGTGCCCGTGGAGGAGAAGG - Intronic
1105368468 13:19782323-19782345 CGGGGTGGCCGCGGGGTCGTGGG - Intronic
1105512447 13:21061650-21061672 CGGAGCGGCCGCGGAGGAGCAGG - Intergenic
1111388639 13:87561889-87561911 CGGGGTGGCGGCGGGGCAGAGGG - Intergenic
1121744384 14:96276788-96276810 CGGGGTGGCCTCGGGGTAGGTGG - Intergenic
1133186895 16:4106394-4106416 CGGTGCTGCCGCGGAACAGAAGG - Intronic
1133722627 16:8509014-8509036 CGGTGGGGCTGCGGAGAAAAGGG + Intergenic
1137438978 16:48482964-48482986 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1139446172 16:67000171-67000193 GAGTGTGGCCGAGGAGTAGGAGG + Intronic
1140602929 16:76500086-76500108 CGGGGTGGCGGCGGGGCAGAGGG + Intronic
1143614192 17:8039702-8039724 TGGTGTGGCCACAGAGTAGCGGG + Intronic
1149779774 17:59388158-59388180 TGGTGTGGGGGCGGAGAAGAGGG - Intronic
1151584911 17:75003137-75003159 CGGGGTGGGGGCGGAGGAGAGGG - Intronic
1161766979 19:6213559-6213581 CGGTGTGGCCTTGGAGCTGAGGG - Intronic
1163556109 19:17993595-17993617 AGGTGGGGCCCCGGAGCAGATGG + Intronic
1168153591 19:54461506-54461528 CGGTGTGGCGGCGGAGGATCTGG - Exonic
936561267 2:113541717-113541739 CGGTCTGGCAGCGGAGAAGGTGG + Intergenic
947658805 2:231851248-231851270 CGGTGCTGCAGCGGAGGAGATGG + Intergenic
1173602216 20:44303950-44303972 GGGAGTGGCCATGGAGTAGATGG - Exonic
1174094258 20:48075523-48075545 TGGTGTGGCCGGGTAGTAGCAGG - Intergenic
1174246877 20:49188229-49188251 CGGAGTGGCCGTGGAGGAGGCGG + Exonic
1176246086 20:64097787-64097809 TGGTGTGCCTGCGGAGTAGAGGG - Exonic
1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG + Intronic
1178873097 21:36392452-36392474 CGGGGTGGCGGCCGGGTAGAGGG + Intronic
1178879990 21:36441850-36441872 GGGTGTGTCACCGGAGTAGAAGG - Intergenic
1182336264 22:29585509-29585531 CAGTGTGGCCGCTGACTAGAAGG + Intergenic
952760342 3:36907978-36908000 CGCTGTGGCCACGGAGTAAATGG + Intronic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
953561387 3:43995841-43995863 AGGTGTGGCCGCGGGGGAGGGGG + Intergenic
953715143 3:45311301-45311323 GGGTTTGGGCGGGGAGTAGAGGG + Intergenic
954152119 3:48662786-48662808 GGCTCCGGCCGCGGAGTAGATGG - Exonic
959201697 3:103255064-103255086 CGGGGTGGCTGCGGGGTGGAGGG + Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969685988 4:8674598-8674620 CGGTGTGGCCGGGGAGGTGGTGG - Intergenic
985551296 5:534838-534860 CGGGGTGGACGCGGAGCTGAGGG + Intergenic
985912988 5:2897531-2897553 CGCTGTGGCTGCTGAGTACACGG + Intergenic
985966546 5:3342578-3342600 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
985966575 5:3342726-3342748 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
987037542 5:14033194-14033216 GGGTGTGGCTGGGGAGGAGAGGG - Intergenic
993654631 5:90562435-90562457 AGGTGTGGCAGAGGAGGAGAAGG + Intronic
996176501 5:120365952-120365974 AGGTGTGGCAGCTGAGGAGATGG + Intergenic
1005710984 6:28502583-28502605 CGGCGTGGCGGCCGAGCAGAGGG - Intergenic
1013530694 6:111017210-111017232 CGGGGTGGCGGCCGGGTAGAGGG + Intronic
1018017589 6:159726691-159726713 CGCTGTGTCCGCGGCGTTGAGGG - Exonic
1019208885 6:170388325-170388347 TGGTGAGGCCGCGGACGAGAAGG - Exonic
1019717013 7:2543757-2543779 GGGGGTGGCCGCGGAGCACAAGG + Exonic
1024109479 7:46130808-46130830 TGTGGTGGCCGCGGAGAAGAGGG - Intergenic
1034533230 7:151710405-151710427 CAGTGTGGCAGCGGAGCAAAGGG - Intronic
1034857310 7:154563722-154563744 AGGTGTGGGAGTGGAGTAGAAGG + Intronic
1042902827 8:73746330-73746352 CGGTGTGGCTGCGAGGGAGAGGG - Intronic
1045652693 8:104356205-104356227 CGATGTGGCTGAGGAGTAGTCGG - Exonic
1049038415 8:140094597-140094619 CGGAGAGGCAGCAGAGTAGAGGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049349652 8:142157701-142157723 CGGTCTAGCCGGGGAGTGGAGGG - Intergenic
1049412374 8:142478977-142478999 TGGGGTGGCCGTGGAGTAGCGGG + Intronic
1049891425 9:73622-73644 CGGTCTGGCAGCGGAGAAGGTGG - Intergenic
1050377151 9:4985172-4985194 CGGTGTGGCCCCGGAGAGGGTGG + Intronic
1050480861 9:6085694-6085716 GGGTGTGGCCACGGACTAGTTGG - Intergenic
1051615145 9:18999636-18999658 CGGTGTGGCGGCCGGGCAGAGGG - Intronic
1053732847 9:41074696-41074718 CGGTCTGGCAGCGGAGAAGGTGG - Intergenic
1054695582 9:68356858-68356880 CGGTCTGGCAGCGGAGAAGGTGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1062450140 9:136611735-136611757 CGGTGTGGCTGCGAAGTCGGAGG + Intergenic
1186857458 X:13639891-13639913 CTGTGTGGCAGAGGAGTGGAGGG - Intergenic
1187212454 X:17244802-17244824 CGGGGTGGCCGCCGGGCAGAGGG + Intergenic
1191894150 X:65975237-65975259 CGGGGTGGCGGCGGGGCAGAGGG + Intergenic
1193114847 X:77766384-77766406 CGGGGTGGCAGCGGGGCAGAGGG + Intronic
1196652687 X:118184686-118184708 CGGTGTGGCCACAGAGAAAAGGG + Intergenic