ID: 1049122855

View in Genome Browser
Species Human (GRCh38)
Location 8:140755454-140755476
Sequence TACTGTCCTGCCCCGCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049122842_1049122855 29 Left 1049122842 8:140755402-140755424 CCCTTTGTTTCCTATCCCTCTAC 0: 1
1: 0
2: 2
3: 41
4: 340
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122852_1049122855 -6 Left 1049122852 8:140755437-140755459 CCGTCCTCCTGGTGGTGTACTGT 0: 1
1: 0
2: 1
3: 11
4: 210
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122847_1049122855 13 Left 1049122847 8:140755418-140755440 CCTCTACTCCGCGGCCACACCGT 0: 1
1: 0
2: 0
3: 1
4: 121
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122853_1049122855 -10 Left 1049122853 8:140755441-140755463 CCTCCTGGTGGTGTACTGTCCTG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122848_1049122855 5 Left 1049122848 8:140755426-140755448 CCGCGGCCACACCGTCCTCCTGG 0: 1
1: 0
2: 0
3: 30
4: 357
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122843_1049122855 28 Left 1049122843 8:140755403-140755425 CCTTTGTTTCCTATCCCTCTACT 0: 1
1: 0
2: 2
3: 26
4: 365
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122845_1049122855 19 Left 1049122845 8:140755412-140755434 CCTATCCCTCTACTCCGCGGCCA 0: 1
1: 0
2: 0
3: 4
4: 93
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122851_1049122855 -1 Left 1049122851 8:140755432-140755454 CCACACCGTCCTCCTGGTGGTGT 0: 1
1: 0
2: 0
3: 23
4: 206
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data
1049122846_1049122855 14 Left 1049122846 8:140755417-140755439 CCCTCTACTCCGCGGCCACACCG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049122855 Original CRISPR TACTGTCCTGCCCCGCCTCA TGG Intronic
No off target data available for this crispr