ID: 1049122860

View in Genome Browser
Species Human (GRCh38)
Location 8:140755466-140755488
Sequence CCGCCTCATGGCCTTTGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049122853_1049122860 2 Left 1049122853 8:140755441-140755463 CCTCCTGGTGGTGTACTGTCCTG 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data
1049122847_1049122860 25 Left 1049122847 8:140755418-140755440 CCTCTACTCCGCGGCCACACCGT 0: 1
1: 0
2: 0
3: 1
4: 121
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data
1049122848_1049122860 17 Left 1049122848 8:140755426-140755448 CCGCGGCCACACCGTCCTCCTGG 0: 1
1: 0
2: 0
3: 30
4: 357
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data
1049122854_1049122860 -1 Left 1049122854 8:140755444-140755466 CCTGGTGGTGTACTGTCCTGCCC 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data
1049122852_1049122860 6 Left 1049122852 8:140755437-140755459 CCGTCCTCCTGGTGGTGTACTGT 0: 1
1: 0
2: 1
3: 11
4: 210
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data
1049122846_1049122860 26 Left 1049122846 8:140755417-140755439 CCCTCTACTCCGCGGCCACACCG 0: 1
1: 0
2: 0
3: 3
4: 86
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data
1049122851_1049122860 11 Left 1049122851 8:140755432-140755454 CCACACCGTCCTCCTGGTGGTGT 0: 1
1: 0
2: 0
3: 23
4: 206
Right 1049122860 8:140755466-140755488 CCGCCTCATGGCCTTTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049122860 Original CRISPR CCGCCTCATGGCCTTTGCAC TGG Intronic
No off target data available for this crispr