ID: 1049124325

View in Genome Browser
Species Human (GRCh38)
Location 8:140773288-140773310
Sequence TTCTAACTCCAGCACCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049124325 Original CRISPR TTCTAACTCCAGCACCTACA TGG (reversed) Intronic
902899281 1:19502935-19502957 TGCTAACTCCATCTCCCACATGG + Intergenic
904198926 1:28806598-28806620 TTCTAGCTTGAGCAACTACATGG + Intergenic
905857481 1:41323510-41323532 TTCTGACTCCATCACTTACCTGG + Intergenic
906213730 1:44026852-44026874 TCCTCACTCGAGCACTTACAAGG - Intronic
907199634 1:52715408-52715430 TTCTAAAACCAGCAACTTCAGGG + Intergenic
908785565 1:67731497-67731519 TTCTAGCTCCAGATCCTGCAGGG - Intronic
908977612 1:69918287-69918309 TTGTAACTCCAGTGCCCACAGGG + Intronic
909682066 1:78302955-78302977 TTCCAACTGTAGCACCTACATGG - Intergenic
911247372 1:95533713-95533735 TTCAATCTCCAGTACCTAGACGG - Intergenic
918608463 1:186458626-186458648 TTTTAACTCCAGTCCCCACAGGG + Intronic
922167097 1:223125320-223125342 TTCTACCCCCTGCACCTGCAAGG + Intronic
923134195 1:231103158-231103180 TTCTAACTACAGCTCCAAAAAGG - Intergenic
1062798987 10:365623-365645 TTCTAAGGCCAGGACCTACTTGG + Intronic
1063155455 10:3375320-3375342 CTCTCACTCCAGCACCCACTGGG - Intergenic
1063159722 10:3410349-3410371 TCCTAACTCCATCACCTGGAGGG - Intergenic
1063970063 10:11375482-11375504 TTCTACCTCCATCACCTTGAGGG + Intergenic
1064876345 10:19998849-19998871 TCCTTACTCTAGCACTTACAAGG - Intronic
1067746391 10:48939435-48939457 TTCTATCTCCACCACTTAAATGG - Intronic
1070157753 10:73846555-73846577 TTGTATCTCCAGCACCCAGACGG + Intronic
1071217507 10:83425344-83425366 TAATAACTCCATCTCCTACATGG - Intergenic
1071829122 10:89354501-89354523 TACGAACTCCATCTCCTACATGG - Intronic
1076289105 10:129330522-129330544 TTATAATTCAAGCACCTCCAGGG + Intergenic
1076334724 10:129698075-129698097 TTCTCACTCCAGAGCCTGCAGGG + Intronic
1077397819 11:2333815-2333837 TTTTAACTCCAGTCCCCACAGGG - Intergenic
1078220094 11:9344562-9344584 TTGCAACTGCAGCAACTACAAGG + Intergenic
1079779691 11:24585076-24585098 TTCTGTCTTCAGCACCTACATGG + Intronic
1080276010 11:30504203-30504225 TTGTAACTCCAGCAGGAACAGGG + Intronic
1080967752 11:37233554-37233576 TACTAACTCCAACTCCCACACGG - Intergenic
1081632563 11:44699775-44699797 TTCTAAAACCAACACCTTCATGG - Intergenic
1081652763 11:44835345-44835367 TACTAACTCCAGTCCCTATATGG - Intronic
1083390748 11:62348281-62348303 TACTAACTCCATCTCCCACATGG - Intronic
1086103496 11:83126030-83126052 TACTAACTACAGGACCTATAGGG - Intergenic
1088333383 11:108676407-108676429 ATATAACTACAGCAGCTACATGG + Intronic
1091766261 12:3121865-3121887 TGCAAACTCAAGTACCTACAAGG - Intronic
1094212404 12:27906205-27906227 TACTAACTCCATCTCCCACATGG - Intergenic
1094354669 12:29565142-29565164 TTCTAACTGCAGCTCCTCCCTGG - Intronic
1097071589 12:56359150-56359172 TTCTACCTCCAGCAGGAACAAGG + Intronic
1097342420 12:58454309-58454331 TTCTAACTCTATTACCTACTAGG + Intergenic
1097430551 12:59499809-59499831 TACTAACTCCATCTCCCACATGG + Intergenic
1101194892 12:102371791-102371813 TTCTAACACCAGCAAGGACAGGG - Intergenic
1102506724 12:113388702-113388724 TTCTAACTCCAGCCCCTCCTGGG + Exonic
1103740502 12:123087939-123087961 TTTTCACTCCAGCCTCTACAAGG + Intronic
1104530072 12:129561526-129561548 TTCTAACTCCAGCACTATCTCGG - Intronic
1105764600 13:23546963-23546985 ATCTAACTCCAGGATCCACACGG + Intergenic
1106469605 13:30042669-30042691 TACTAACTCCATCTCCTACATGG + Intergenic
1107819427 13:44272857-44272879 TTCCAAGTCCAGTACCTCCAGGG + Intergenic
1107925823 13:45260904-45260926 CTCGAACTCCAGGAACTACAGGG - Intronic
1110182311 13:72632399-72632421 ATCTAATTCCAGAACCTATAAGG + Intergenic
1111975026 13:94957341-94957363 TTCAACCTCCACCTCCTACATGG + Intergenic
1112560067 13:100505055-100505077 TTCTGACTCCAGATCCTAAATGG + Intronic
1112589238 13:100748622-100748644 TTTTATCTCCAGAACCTGCAAGG - Intergenic
1113301120 13:109020370-109020392 TTCTTACTTCAACACCTTCAAGG + Intronic
1115192429 14:30759986-30760008 TTCAGAGCCCAGCACCTACATGG + Intergenic
1115286786 14:31722815-31722837 ATCTAATTCCAGCATCTATAAGG - Intronic
1115464585 14:33700928-33700950 TTTTTCCTCCAGAACCTACATGG - Intronic
1118792903 14:69111902-69111924 TTCCAACTCCAGTGTCTACAGGG + Intronic
1119164222 14:72479120-72479142 TTTTAAGCCCAGCTCCTACAGGG + Intronic
1120219707 14:81718519-81718541 TTCTACCTCCAGGATCCACAAGG - Intergenic
1120394646 14:83953931-83953953 TTCTAACTCCACAACCTTGAGGG - Intergenic
1121601295 14:95205365-95205387 TTCTAACTCCGGGTCCTATATGG - Intronic
1122232036 14:100311154-100311176 TTCTAACACCATCACCTCCGGGG - Intergenic
1123724656 15:23090094-23090116 GTCAAACTCCAGCACCTATTGGG - Intergenic
1124645977 15:31437772-31437794 TTCTCTCTCCTGCACCTGCAGGG - Intergenic
1125270838 15:37936936-37936958 TTCTTCCTCCAGCTCCTGCAAGG - Exonic
1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG + Intergenic
1129509532 15:76110605-76110627 TTTGACCTCCAGCACCTACTGGG - Intronic
1129889866 15:79064929-79064951 CTCTAACCCCAGGACCTAGAAGG - Intronic
1133119448 16:3597199-3597221 TTCTCTGTCCAGCAACTACATGG - Intronic
1136123227 16:28155687-28155709 TTATAACTCCTGTACCTCCACGG + Intronic
1138063737 16:53918837-53918859 TTCTAACTCCAGGCCCAGCACGG - Intronic
1144348712 17:14373513-14373535 TTCCATTTTCAGCACCTACAGGG - Intergenic
1144469417 17:15524159-15524181 TTCTAACTCCAGGAACAAAATGG - Intronic
1144926938 17:18819518-18819540 TTCTAACTCCAGGAACAAAATGG + Intergenic
1145709039 17:26951842-26951864 TTCTTACGCCACCACCTCCATGG + Intergenic
1147473539 17:40687047-40687069 TTCAATCTCCAGGGCCTACAAGG + Intergenic
1150588564 17:66540525-66540547 TTCTAACTGCAGCCCCCGCACGG - Intronic
1157439515 18:47699833-47699855 TTGTAGCCCCAGCACCTAGAAGG - Intergenic
1161679286 19:5671447-5671469 CCCTAACTGCATCACCTACATGG + Intergenic
1165963678 19:39556303-39556325 TTTTTTCTCCAGGACCTACATGG - Intergenic
1167799287 19:51729846-51729868 GTCTAACTCCAGCCCATCCAAGG - Intergenic
1168486357 19:56765510-56765532 TGCTAGCTCCCTCACCTACACGG - Intergenic
925147588 2:1591499-1591521 TTCACAGTCCAGCACCCACAAGG - Intergenic
925566988 2:5266678-5266700 TTCTTGGTCCAGCAGCTACATGG - Intergenic
926623622 2:15070878-15070900 ATCTCACAGCAGCACCTACATGG + Intergenic
927497165 2:23558718-23558740 TTCTTACTCCAGCACCTACGTGG + Intronic
930754748 2:54962819-54962841 TTCTAACTCGATCTCCTACCTGG - Intronic
933235504 2:79859779-79859801 CTCTGACTCCAGCAGCTAAATGG - Intronic
933567547 2:83969314-83969336 TGCTCACCCCAGCACCCACAAGG - Intergenic
933974319 2:87496249-87496271 TATTAACACCACCACCTACAGGG - Intergenic
934303405 2:91798387-91798409 TTCTCATGCCACCACCTACAAGG + Intergenic
934329856 2:92054370-92054392 TTCTCATGCCACCACCTACAAGG - Intergenic
934901409 2:98162843-98162865 CTCTGACTCCAGCTCCTAAAAGG - Exonic
935898099 2:107759477-107759499 TTCTAACCCCATGAGCTACAAGG + Intergenic
936319505 2:111454570-111454592 TATTAACACCACCACCTACAGGG + Intergenic
937073950 2:119087486-119087508 TCCAAACCCCAGCACCCACAGGG - Intergenic
937546879 2:123033067-123033089 GTCTAATTCCACCACCTATAAGG + Intergenic
938384087 2:130852427-130852449 TTCTGCCTCCAGGACCTCCAAGG + Intronic
942121125 2:172778545-172778567 TTTTCACACCAGCAACTACAAGG - Intronic
942136823 2:172934502-172934524 TTGTATCTCCAGAGCCTACATGG - Intronic
942337232 2:174901631-174901653 TTGTATCTCCAGCACCTAGAAGG + Intronic
944187184 2:196961832-196961854 TTCCATCTCCAGCATCTAAAAGG - Intergenic
944203300 2:197131513-197131535 TCGTAACTACAACACCTACATGG + Intronic
945457513 2:210066549-210066571 TTCCAACTCAAAAACCTACACGG + Intronic
946977326 2:225167768-225167790 TTGTAACTCAACCACCTACAGGG + Intergenic
947911599 2:233804234-233804256 TTAGAACCCCAGCACATACACGG - Intronic
948175682 2:235940786-235940808 TTCTAACTCCACCACAGAGAGGG + Intronic
1170819637 20:19745495-19745517 TTCATACTCCAACACATACAGGG + Intergenic
1172092491 20:32443878-32443900 TTCTGACTCCTGCTCCTAAATGG + Exonic
1172567857 20:35945065-35945087 TCCTAATTCCAGCAAGTACAAGG - Intronic
1174347561 20:49941778-49941800 CTCTAACTTCAGCAACAACATGG - Intronic
1177133623 21:17286990-17287012 GTCTAATTCCAGAATCTACAAGG + Intergenic
1180525375 22:16254220-16254242 TTCTCATGCCACCACCTACATGG + Intergenic
1182629083 22:31670724-31670746 TTCTATTACCAGGACCTACAAGG - Intergenic
1184788964 22:46687523-46687545 CTCGAACTCCAGCACCCCCATGG + Intronic
949549724 3:5102772-5102794 TCCCATCTCCAGAACCTACATGG + Intergenic
951677163 3:25254653-25254675 TTCTCACTGCAACACCCACAAGG - Intronic
952032173 3:29156391-29156413 TTCTAAATGCAGCACATAAATGG + Intergenic
953024521 3:39137180-39137202 GTCTAACACCTGCAGCTACATGG + Exonic
954546588 3:51441271-51441293 TTCTAACTCTACCACAAACAAGG - Intronic
959479871 3:106858328-106858350 GTCTAAATCCAGAATCTACAAGG + Intergenic
959807080 3:110568252-110568274 CTCAATCTCCAGCACCTTCAGGG - Intergenic
962724144 3:138205444-138205466 TTATAACTTCAGCACTTACCTGG + Intronic
965692510 3:171372537-171372559 TCCTAGCTCCAGCACTTCCATGG - Intronic
966230019 3:177641477-177641499 TACTAACTCCAGCATCACCAAGG - Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
969120778 4:4909443-4909465 TTTTCAATCCAGCACCTTCAGGG + Intergenic
970677139 4:18463888-18463910 CTCTCACTCCATCTCCTACATGG - Intergenic
971245834 4:24926859-24926881 TGTTAACTGGAGCACCTACACGG + Intronic
971592867 4:28491193-28491215 TTATAACTCCAGTACCTATAGGG + Intergenic
972213977 4:36873991-36874013 ATCTACCTCCAGAACCTACCTGG + Intergenic
972245288 4:37240817-37240839 CACTACCTCCAGCACCTACGAGG + Intergenic
977434257 4:96972953-96972975 TTCTAACGCCATCACCTTAAGGG + Intergenic
978111876 4:104974436-104974458 TTCTATCACCAGAACATACAAGG + Intergenic
983535915 4:168856756-168856778 GTCTAACTCCAGAGCCTACATGG + Intronic
985126661 4:186701560-186701582 TTCTAGCCCCAGCTCCCACAGGG + Intronic
986307212 5:6524774-6524796 TTCCAACTCCAGCATCCTCATGG + Intergenic
990871757 5:60439601-60439623 TTCTCACTCAAACATCTACATGG - Intronic
991281071 5:64914076-64914098 CTCTAATTCCAGCACCATCATGG - Intronic
993893405 5:93502540-93502562 TTCTAACTTCACTACTTACATGG - Intergenic
993902198 5:93592101-93592123 TTCTAACACCTTCATCTACAAGG - Intronic
996852436 5:127967451-127967473 TACTAACTCCATCTCCCACATGG + Intergenic
998820233 5:146051356-146051378 TTCTCAATCCAGCAAATACAGGG - Intronic
999715290 5:154355406-154355428 TTCAAGCTCCAGGACCTCCAGGG - Intronic
999859247 5:155627822-155627844 ATCTTACTCCAGCACCTAATGGG - Intergenic
1002381222 5:178831442-178831464 TCCTGACTCCACCACCCACAGGG + Intergenic
1003127321 6:3365522-3365544 CTCCATCTCCAGCACCTAAATGG - Intronic
1003833542 6:10041715-10041737 TTATAAATCCAGAATCTACAAGG - Intronic
1004167050 6:13266143-13266165 TTCTAACTCATGCAACTAGATGG - Intronic
1005145676 6:22687270-22687292 TTACAACTCCATCACCCACAGGG + Intergenic
1006997951 6:38280233-38280255 TTCAGACTTCAGCACCTACTGGG + Intronic
1007219178 6:40265056-40265078 CTCCAACACCAGCACCTTCAGGG + Intergenic
1010509466 6:76700836-76700858 TTCTACCTCCGGGAGCTACAGGG + Intergenic
1010951520 6:82042343-82042365 TTCCAACTACAGCAACTAGATGG - Intergenic
1012016502 6:93859048-93859070 TTCTAACTTCAGCACCAATTAGG + Intergenic
1014803693 6:125805999-125806021 TCCAGACTCCACCACCTACAAGG - Intronic
1015855102 6:137616032-137616054 TTCTGCCTGCAGCACCTTCAGGG + Intergenic
1022544911 7:31177456-31177478 TTCTAACTCTGGAACCTCCAAGG - Intergenic
1023165528 7:37339692-37339714 TTGTAATTCCAGCAACTGCAGGG + Intronic
1028883755 7:95909290-95909312 TTCGAACTCTAGCAGCAACAAGG + Intronic
1030589852 7:111467160-111467182 TCCTCACCCCAGCACCTACTGGG + Intronic
1033713405 7:143974067-143974089 CTCCAACTCCAGCACTCACAGGG + Intergenic
1033906891 7:146216427-146216449 CTTTAACTGCAGCACCAACAAGG - Intronic
1040704488 8:50109413-50109435 GTCTAAGTCCAGCACCTCAATGG + Intronic
1046194531 8:110842575-110842597 TTGTAACTCCAGCAACCAGACGG + Intergenic
1047278888 8:123427585-123427607 TTCTAACTCAGCCACTTACAAGG - Intronic
1047447942 8:124936881-124936903 TTCTGACTCCAGAAACAACAAGG + Intergenic
1047722167 8:127651213-127651235 GTCTAGCTCCAGCACATATACGG + Intergenic
1049124325 8:140773288-140773310 TTCTAACTCCAGCACCTACATGG - Intronic
1049161820 8:141102900-141102922 TCCTAACTCCTGCACCCACCAGG - Intergenic
1050103143 9:2139244-2139266 TACTAACTCCATCTCCCACATGG - Intronic
1051130655 9:13856430-13856452 TTCTAATACCATCACCTTCAGGG + Intergenic
1051333667 9:16047390-16047412 TTCTACCTCCAGCATCTCCTAGG + Intronic
1051961517 9:22769939-22769961 TTCTGACTTCAGCTCCTACACGG - Intergenic
1055097139 9:72425119-72425141 TTTTCACTCAAGCATCTACAGGG - Intergenic
1056271917 9:84955155-84955177 TTTTAGCACCAGCAGCTACAGGG + Intronic
1057896187 9:98910737-98910759 TTCTAAACTCAGCACATACAGGG - Intergenic
1187768784 X:22672172-22672194 TTCTAACACCATCACCTTCGGGG - Intergenic
1190123751 X:47685304-47685326 TTCTAACCTTAGCACCTGCAGGG + Intergenic
1192550127 X:72047073-72047095 TTTTAACTTCACCACCTTCAAGG - Intergenic
1197396809 X:125937571-125937593 GTCTAATTCCAGAACTTACAAGG - Intergenic
1199581677 X:149366789-149366811 TTCAAACTCAAACACCTACAGGG - Intergenic
1201653189 Y:16314347-16314369 TAATAACTCCATCTCCTACATGG - Intergenic