ID: 1049125355

View in Genome Browser
Species Human (GRCh38)
Location 8:140782138-140782160
Sequence TTTTATGTGCACAAAGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049125355 Original CRISPR TTTTATGTGCACAAAGTAGT AGG (reversed) Intronic
900618522 1:3576410-3576432 TTTCATTTGAACAAAGGAGTTGG - Intronic
901044027 1:6384858-6384880 TTTTATGTTCACAGAGCTGTGGG - Intronic
905779706 1:40697436-40697458 TTTTGAATGCACAAAGTAGTAGG + Intronic
906170634 1:43722066-43722088 TTATAAGTGCACAATGTAATGGG + Intronic
906768371 1:48458325-48458347 TTTTATGGCCAAAAAATAGTTGG - Intronic
907533952 1:55130893-55130915 CTTTAGGTACACAAAATAGTTGG - Intronic
909806825 1:79882821-79882843 TTTTATGTACACAAAATAACTGG - Intergenic
909838760 1:80290899-80290921 TTTCATGTGCACACAGTGGAAGG + Intergenic
917087178 1:171315438-171315460 TTTTTTGTGCACCAATTACTTGG + Intronic
918332803 1:183475347-183475369 TTTTATCTGGACAAAGTGGTCGG + Intronic
918564206 1:185907973-185907995 TTTTGGATGCACAAAGAAGTAGG + Intronic
919962147 1:202482239-202482261 TTGGATGTGTACACAGTAGTGGG + Intronic
921258984 1:213368874-213368896 TTTTATGTGCAAGATGAAGTAGG + Intergenic
921806214 1:219458563-219458585 TTTTAAGTACAGAAAGAAGTTGG - Intergenic
923173480 1:231439743-231439765 TTTTATGTGAACATAATAGAAGG + Intergenic
1062984721 10:1757545-1757567 TTTGCTGTGCTCAAAGTAGAAGG + Intergenic
1063056729 10:2513203-2513225 TTATATGCAGACAAAGTAGTAGG + Intergenic
1065041552 10:21702834-21702856 TTTTGTGGGCAATAAGTAGTTGG + Intronic
1065245476 10:23751948-23751970 TTTTATAGGCAAAAAGTAGGTGG + Intronic
1066016825 10:31254504-31254526 GTTAATTTGCACAAAGTATTTGG - Intergenic
1066295381 10:34049556-34049578 TTTTATGGGTACATAGTAGATGG - Intergenic
1068400815 10:56525756-56525778 TTTAACTTGCACAAAGAAGTAGG + Intergenic
1072036929 10:91571645-91571667 TTTTTTATGCAAAAATTAGTTGG + Intergenic
1073621915 10:105058946-105058968 TTTTATTTGTGCAAAGTTGTGGG - Intronic
1078667065 11:13334596-13334618 TTTTATGGCCAGAAAGTAGAAGG + Intronic
1079237864 11:18702415-18702437 TTTCATCTGCACAAAGTTGAGGG + Exonic
1079510801 11:21207563-21207585 TTATTTGTACATAAAGTAGTAGG - Intronic
1079724961 11:23869244-23869266 CTTTCTGTGCAGCAAGTAGTAGG + Intergenic
1080732192 11:34968350-34968372 TTTTATGTTAGCAAAGTACTTGG - Intronic
1087991230 11:104746895-104746917 TTTTATGGGCACAGAATGGTAGG - Intergenic
1090511269 11:127377613-127377635 TTTGATGTGCTCAAAATAGTTGG - Intergenic
1093183801 12:15996887-15996909 TTTTATCTGCAAAAAGCATTTGG + Intronic
1093243387 12:16705689-16705711 TTTTATTTGCACAAATTTATGGG - Intergenic
1094210985 12:27891425-27891447 TTAAATGTACACCAAGTAGTGGG + Intergenic
1094279309 12:28717789-28717811 TTTCATGTTCCCAAAGAAGTGGG + Intergenic
1096598482 12:52713451-52713473 TTTTATTTGAAAAAAGTCGTAGG - Intergenic
1097978886 12:65716913-65716935 TTTTGTGTGCACAGAGAATTTGG + Intergenic
1099543827 12:83950861-83950883 TTTTATGGGCACAAAATGGGGGG - Intergenic
1099653240 12:85456525-85456547 TTTTATGAGCACAAGGTTGGGGG - Intergenic
1100890123 12:99116119-99116141 TTTTATGTGCGTAAAGTGCTAGG + Intronic
1102612818 12:114127628-114127650 ATTTCTGTGCACAGAGCAGTTGG - Intergenic
1103081386 12:118026755-118026777 TTCTATGGGCACAAGGCAGTGGG - Intronic
1106878152 13:34098641-34098663 TTTTATGTGGACAAAGTGTGGGG + Intergenic
1107365711 13:39671995-39672017 TTTTCTGTGTAGAAAGGAGTGGG - Intronic
1110807722 13:79776967-79776989 TTTTATGTGCAGTATTTAGTTGG + Intergenic
1111357422 13:87126657-87126679 CTTTATGTCCCCAAAGTATTTGG - Intergenic
1111385270 13:87518978-87519000 TTTTATGTTCACAATTTTGTTGG - Intergenic
1112841362 13:103582805-103582827 TTGTAACAGCACAAAGTAGTAGG + Intergenic
1113548450 13:111173357-111173379 TTTTATCTTCACAGAGTAGCAGG + Intronic
1115273524 14:31580922-31580944 TTTTCTGTGTACAGTGTAGTGGG + Intronic
1115713323 14:36074417-36074439 TTTTATTTGCGCAAATTTGTGGG - Intergenic
1115864280 14:37726164-37726186 TTTTATTTGCACAGCGTTGTAGG + Intronic
1116375435 14:44193360-44193382 TTATATGTGCAAAATGTGGTTGG + Intergenic
1119763954 14:77176244-77176266 TTTCCTGTGCAGAAAGTAGTGGG - Intronic
1119775688 14:77247085-77247107 CTTTATGTGCACAAAATACATGG + Intronic
1120073535 14:80130159-80130181 TTTAATATGCAAAAAGTTGTGGG + Intergenic
1122189827 14:100032487-100032509 TTTTATATCCACAAAGTACTGGG - Intronic
1128321903 15:66700712-66700734 TTTAATTTGGCCAAAGTAGTAGG + Intergenic
1128759209 15:70204022-70204044 GTTTATGTGCCCACAGTAGTGGG + Intergenic
1132127774 15:99244104-99244126 TTTTGTGAGTACATAGTAGTAGG - Intronic
1132288219 15:100681271-100681293 TTTCATGGGCACAAAGGACTGGG + Intergenic
1132637503 16:959509-959531 TTCAATGTGCACAAACTATTGGG + Intronic
1134319249 16:13147922-13147944 TTTACTGGGCACAAAGTATTTGG - Intronic
1135883369 16:26280931-26280953 TTTTATATGTACAAGGAAGTTGG + Intergenic
1139663247 16:68436526-68436548 TTTTCTTTGCACATAGTAGTAGG + Intronic
1139844452 16:69909873-69909895 TTTCATCTGTACAAACTAGTCGG + Intronic
1141007282 16:80364068-80364090 TTTTACGTGAAAAAATTAGTTGG - Intergenic
1152268966 17:79312686-79312708 TTTTATGTGCATGAAGGAGCTGG - Intronic
1152351852 17:79788482-79788504 TTTTCTGTGCCCCAAGTATTTGG - Intergenic
1154992068 18:21606876-21606898 TTTTATCAGCCCAAAGTAGGAGG + Intergenic
1156171230 18:34488965-34488987 ATTAATGTGCAATAAGTAGTAGG + Intergenic
1158541799 18:58363436-58363458 TTTTATGAGCAAAAAGGATTGGG - Intronic
1158892503 18:61886008-61886030 TTTTTTGTGGGCAAAGTAGGAGG + Intronic
1159576709 18:70187238-70187260 TCTTATGTGCATAGAATAGTAGG - Intronic
1159654236 18:71012528-71012550 GTATATGTGCACAACGTAGCAGG + Intergenic
1159927804 18:74284284-74284306 TTTTATGTGCAAAAAGCACTTGG + Intronic
1164009212 19:21183623-21183645 TCTTATGTGCAGTAAGTTGTGGG - Exonic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1164969286 19:32517126-32517148 TTTTATGTGTACATAGTAGGTGG + Intergenic
1165650496 19:37484144-37484166 TCTTTTGTGTACAAAGCAGTGGG - Exonic
1167895151 19:52574532-52574554 ATTAATGTGCACAAAGTACGTGG + Intronic
1167910572 19:52698759-52698781 ATTAATGTGCACAAAGTACGTGG - Intergenic
1167925406 19:52817553-52817575 ATTAATGTGCACAAAGTACGTGG - Intronic
1167988993 19:53341692-53341714 ATTCATGTGCACAAAGTAGGTGG + Intronic
1167995486 19:53398399-53398421 ATTCATGTGCACAAAGTATGTGG + Intronic
1168001245 19:53447653-53447675 ATTCATGTGCACAAAGTATGTGG + Intronic
1168005625 19:53484207-53484229 ATTCATGTGCACAAAGTACGTGG + Intronic
927043821 2:19256731-19256753 TTCTCTTTGCACAAAGGAGTGGG + Intergenic
927379487 2:22462409-22462431 ATTTCTGTTCACAAACTAGTGGG - Intergenic
929307666 2:40382050-40382072 TTTTCTGTGCAGCAAGCAGTAGG + Intronic
930108203 2:47656522-47656544 TTTTGTTTGACCAAAGTAGTTGG + Intergenic
930467956 2:51778435-51778457 TTTCACGTTCACTAAGTAGTAGG - Intergenic
930544888 2:52754381-52754403 TTTAATTTGCACAAATTAGATGG - Intergenic
931675637 2:64693491-64693513 TTTTATGGGTACATAGTAGGTGG + Intronic
932860951 2:75290703-75290725 ATTTCTGTGCTCAGAGTAGTGGG - Intergenic
933349395 2:81134843-81134865 TTTGATGTGATCAAAGAAGTAGG + Intergenic
933982470 2:87563201-87563223 TTTTGTGTGCACAGATTATTTGG - Intergenic
935311686 2:101789978-101790000 TTTTAAGTGTATAAAGAAGTCGG - Intronic
936311373 2:111387592-111387614 TTTTGTGTGCACAGATTATTTGG + Intergenic
936954208 2:118008322-118008344 TTTTCTGTGCACAAAGCTTTAGG - Intronic
941889310 2:170561540-170561562 TTTTATGTGCAAAATGTTGCCGG - Intronic
941940641 2:171033756-171033778 TTTTATGGGTACATAGTATTAGG - Intronic
942505279 2:176635685-176635707 TTGTTTATGCAGAAAGTAGTAGG + Intergenic
943827457 2:192414186-192414208 TTTTCAGTGCCCAAAGTATTGGG - Intergenic
945545444 2:211144847-211144869 TTTTATGTGCTCAGAATAGGGGG - Intergenic
946680206 2:222205883-222205905 CTTTCTGTGCACAAAGAAGTTGG + Intronic
947037089 2:225871748-225871770 TTTTATGTGCACTTATTTGTAGG + Intergenic
947820773 2:233067971-233067993 TTTTATGTGTGCAAAGCATTCGG - Intronic
1169526828 20:6437477-6437499 CTTTATCTACACAAAGTTGTTGG - Intergenic
1169599816 20:7245211-7245233 TTTTATTTCAACAAAGTATTCGG - Intergenic
1169834007 20:9857597-9857619 ATCTATATGCTCAAAGTAGTGGG + Intergenic
1170380700 20:15756661-15756683 TTTTGTGTGCAAAAAGGAGCAGG - Intronic
1176003372 20:62845063-62845085 TTCTGAGTGCACACAGTAGTTGG - Intronic
1178134786 21:29614835-29614857 TATTATGTGCACAAAGTCTGGGG - Intronic
949426273 3:3919765-3919787 TTTTATGAGCACATAATAGGAGG - Intronic
950813394 3:15672561-15672583 TTTTATTTGTTCAAAGTAGCTGG + Intronic
951069301 3:18307641-18307663 TGGTATGTGCTCACAGTAGTAGG - Intronic
951843445 3:27059899-27059921 TTTTATTTGCACTTACTAGTCGG - Intergenic
952239215 3:31512489-31512511 TTTTATTTGTATAAAGTTGTGGG + Intergenic
953988670 3:47466171-47466193 TTTTCTTTGGACAAAGTAATGGG - Intronic
958840326 3:99196377-99196399 ATTTATGTGAACAAAGTTATTGG - Intergenic
959721033 3:109489410-109489432 ATTTATATGCAAAAAGAAGTTGG + Intergenic
964022186 3:152025801-152025823 TTTTATGGGTACATAGTAGTTGG - Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964703334 3:159592697-159592719 TGTTATATGAACAAAGTAGAGGG - Intronic
965152924 3:165005467-165005489 TGTCATGTGCACATAGTAGGTGG - Intronic
965199647 3:165641167-165641189 TTTTAAGTACACAATGTAGTTGG + Intergenic
965907270 3:173724569-173724591 TTTTAAGTGCAAATAGTAGCCGG - Intronic
971080399 4:23203521-23203543 GTTTATGTGCTTAAAGTATTTGG - Intergenic
971492335 4:27226174-27226196 TTTTATGTGCACACAATCATTGG + Intergenic
971646283 4:29208725-29208747 TTTTATAATCACTAAGTAGTTGG - Intergenic
974257165 4:59473100-59473122 TTTAAAGTGTACAAATTAGTGGG - Intergenic
974596993 4:64026986-64027008 TTTTATGGGGACAAAGCAGGTGG + Intergenic
975120405 4:70722145-70722167 TTTTTTCTGCACAAAGGAGGAGG + Exonic
976192993 4:82506745-82506767 ATTTATGTCCAAAAAGTTGTGGG + Intronic
977029964 4:91870730-91870752 ATTTATGGGCATAACGTAGTAGG - Intergenic
977901311 4:102425376-102425398 ATTTATGTGCACAAATTAAAAGG + Intronic
979566530 4:122160073-122160095 ATTTATGTGCACAAAGATGCTGG + Intronic
981312182 4:143308003-143308025 TTGTCAGTGGACAAAGTAGTAGG - Intergenic
981470633 4:145130615-145130637 TTTTACATGCTGAAAGTAGTAGG + Intronic
982553809 4:156835874-156835896 TTTTCAGTACACAAAGTATTGGG - Intronic
982555581 4:156858947-156858969 TTGTATGCTCACAAAGTAATAGG - Intronic
982869175 4:160553948-160553970 TTTTATGGGTACAGAGTAGGGGG + Intergenic
983363070 4:166751639-166751661 TTTTATGTACACAAAAGACTAGG + Intronic
984911064 4:184674565-184674587 TTTTATCTGCATAGAGAAGTTGG - Intronic
985029791 4:185777918-185777940 TTTTATTTGTACAAATTTGTGGG - Intronic
986009953 5:3704634-3704656 TTTTATGAAGTCAAAGTAGTCGG + Intergenic
986405836 5:7424053-7424075 TTTTATTTGTACAAAGTTATGGG - Intronic
987012297 5:13779914-13779936 TTTTATGTACAGAAAATAGAAGG - Intronic
987859615 5:23467734-23467756 TTTTAAGTTCACAAGGTTGTTGG - Intergenic
988047444 5:25974285-25974307 TTTTATAATCACAAAGTATTTGG - Intergenic
988342523 5:29992116-29992138 TTTTATGTGCACAGTGTAATGGG + Intergenic
990105488 5:52253655-52253677 TTTTAAGTGTATAAAGTAATTGG - Intergenic
992472037 5:77067448-77067470 TTTTATGGCCTCAAAGTAATGGG - Intergenic
994166253 5:96611619-96611641 TTTGCTGTGCAGAAAGTATTTGG - Intronic
994433262 5:99695573-99695595 TTTTATGGGCACAGGGTAGGGGG + Intergenic
994828844 5:104750909-104750931 TTTTGTGTGCATAATTTAGTGGG + Intergenic
994991875 5:107007083-107007105 TTTTATGTCCACAAAGAACACGG - Intergenic
995158173 5:108941003-108941025 TCTTAGGTACATAAAGTAGTGGG + Intronic
995368456 5:111390443-111390465 TTTTAAGTTCTCAAAGTAGCTGG - Intronic
995781818 5:115784573-115784595 TCTTGGGTGCACAAAGCAGTGGG - Intergenic
996705028 5:126489056-126489078 TTTTATTTCCACAAAGAAATAGG + Intronic
998872273 5:146564422-146564444 TTTTATGTGCCCTGAGCAGTTGG + Intergenic
999088810 5:148916977-148916999 TTTTATTTTCACAAACTAGCAGG + Intergenic
1000658936 5:163915619-163915641 TTTTATGGGCACAGGATAGTGGG + Intergenic
1001195622 5:169670918-169670940 TTGTATTTGCATAATGTAGTTGG + Intronic
1005491669 6:26353068-26353090 TTTTATGAGCACATAGTAAGTGG + Intergenic
1006034581 6:31201581-31201603 TTTTATGTTTACAAAGTGATAGG + Intronic
1006619060 6:35349699-35349721 TTTAATGGGTACATAGTAGTAGG + Intronic
1007875924 6:45100836-45100858 TTGTATGTGGACCCAGTAGTGGG - Intronic
1008022317 6:46593861-46593883 TTTTCTATGGACAAAGTAGGAGG - Intronic
1008486542 6:52042144-52042166 TTTTATGTGCAGAAACAAGGTGG + Intronic
1009641277 6:66340402-66340424 TTTTACGTGAACTAAATAGTAGG + Intergenic
1009877448 6:69522475-69522497 TTTTCTGTGCAGAAACTAGTTGG - Intergenic
1010097329 6:72062307-72062329 GTTTATGTGCACAAACTACTTGG + Intronic
1012740495 6:103010208-103010230 TTTTATCTGCACAAATCAATAGG - Intergenic
1024555925 7:50603701-50603723 TTTTATCTTCATAAGGTAGTGGG - Intronic
1028654382 7:93186508-93186530 TTTTAGTTTCACAAAGCAGTAGG - Intergenic
1029328222 7:99828307-99828329 TTTTATGTGTTCACAGTATTTGG - Intronic
1030568045 7:111185729-111185751 ATTTAAGTGAACAAAGTGGTTGG - Intronic
1030686904 7:112496439-112496461 TTTTATTTGCAGAAAGAAGGGGG + Intergenic
1030986769 7:116250732-116250754 TTTTATGTACAGACAGTAGTTGG + Intronic
1032458815 7:132094237-132094259 TCATCTGTGCACAAAGTGGTTGG + Intergenic
1036518924 8:9472389-9472411 CTTTCTGTGCACCAAGTAGCAGG + Intergenic
1038284085 8:26191309-26191331 TTTTATTTGTACAAAGTTATGGG - Intergenic
1041178882 8:55227260-55227282 GTCTTTGTGCACAATGTAGTGGG - Intronic
1041673457 8:60516009-60516031 TTTTATGTGTAACAAATAGTGGG - Intergenic
1041819419 8:62013065-62013087 TTTTATGGGCAGAAAGTATAAGG - Intergenic
1042335397 8:67624903-67624925 CTTTATGTGCAGAAAGCAGCAGG - Intronic
1043077471 8:75720110-75720132 TTTTATGGGCACAAAATGGGGGG - Intergenic
1043089659 8:75882227-75882249 TTTTCTGTGAAGAAAGTATTTGG + Intergenic
1043638734 8:82421483-82421505 TGTTATGTTCACAAAATAATAGG - Intergenic
1043927488 8:86053575-86053597 TTTTATGAACACCAATTAGTGGG + Intronic
1044397695 8:91732700-91732722 TTTTATGTGCATAAACATGTAGG + Intergenic
1045119790 8:99023907-99023929 TTGTATGTACACCCAGTAGTGGG + Intronic
1045144528 8:99326105-99326127 TTTTCTGTGCACAGAATAGAAGG - Intronic
1046568564 8:115933047-115933069 TTTCATGTGCAGAAAGTGGTAGG + Intergenic
1048675737 8:136777407-136777429 TATTATTAGCACAGAGTAGTAGG - Intergenic
1048714347 8:137251302-137251324 TTTTATTTGTACAAAGTTTTGGG - Intergenic
1049125355 8:140782138-140782160 TTTTATGTGCACAAAGTAGTAGG - Intronic
1056627901 9:88269235-88269257 TTTTCTGTGCAGCAAGTAGCAGG + Intergenic
1056911581 9:90705878-90705900 TTCCATGTGCACATAATAGTTGG - Intergenic
1057850288 9:98561464-98561486 TATTAAGTGCTCAAATTAGTAGG + Intronic
1059654152 9:116342004-116342026 CTTAATGTGCACAAAATAATTGG + Intronic
1187961402 X:24569868-24569890 TTTTAAGTGCACAATTTAGTGGG - Intronic
1188739593 X:33761933-33761955 TTTTATGCGTACTATGTAGTTGG + Intergenic
1189714452 X:43851348-43851370 TTTTATGGGTACATAGTAGGTGG + Intronic
1190084536 X:47383750-47383772 TTTCATGTGCACAAAGCTTTGGG - Intronic
1191772309 X:64774586-64774608 TTTTATCTGCACAAATTATGGGG - Intergenic
1192302722 X:69922832-69922854 ATTGTTGTGCACAAAGTAGAGGG + Intronic
1193642652 X:84030059-84030081 TGTTATCTGCCCAAAATAGTGGG + Intergenic
1193934913 X:87606586-87606608 TTTTATGTTCTCAAATTTGTTGG - Intronic
1194211012 X:91068804-91068826 TTTCATATCCACATAGTAGTGGG - Intergenic
1194683565 X:96883795-96883817 TTTTAGGAGCACAAAGTGCTTGG - Intronic
1195529147 X:105931884-105931906 TTTTAAGTGTACAAACCAGTTGG + Intronic
1195722482 X:107879541-107879563 TTTTATGGGCACAGGGTGGTGGG + Intronic
1196222080 X:113123196-113123218 TTTTATGGGGAAAAAGGAGTAGG - Intergenic
1196971115 X:121109779-121109801 TTTTCTGGGCAGAATGTAGTGGG + Intergenic
1198410767 X:136365160-136365182 TTTAATGTGTACAATTTAGTGGG + Intronic
1198534954 X:137575844-137575866 TTTTCAGTGCACAAAGAAGACGG + Intronic
1199560838 X:149160993-149161015 TTTTGTGAGCACACAGTAGTGGG + Intergenic
1199872232 X:151909885-151909907 TTTTATTTCTACAAAATAGTTGG - Intergenic