ID: 1049126896

View in Genome Browser
Species Human (GRCh38)
Location 8:140798273-140798295
Sequence TTAAAGTCAAACATCTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 226}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049126896_1049126898 13 Left 1049126896 8:140798273-140798295 CCACTAAAGATGTTTGACTTTAA 0: 1
1: 0
2: 0
3: 21
4: 226
Right 1049126898 8:140798309-140798331 AGGCAATGTATCTTCACCTTAGG No data
1049126896_1049126899 14 Left 1049126896 8:140798273-140798295 CCACTAAAGATGTTTGACTTTAA 0: 1
1: 0
2: 0
3: 21
4: 226
Right 1049126899 8:140798310-140798332 GGCAATGTATCTTCACCTTAGGG No data
1049126896_1049126897 -7 Left 1049126896 8:140798273-140798295 CCACTAAAGATGTTTGACTTTAA 0: 1
1: 0
2: 0
3: 21
4: 226
Right 1049126897 8:140798289-140798311 ACTTTAATATTATTTTAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049126896 Original CRISPR TTAAAGTCAAACATCTTTAG TGG (reversed) Intronic
900029902 1:363857-363879 TTTAAGTCAAACATTGTGAGTGG - Intergenic
900050554 1:592921-592943 TTTAAGTCAAACATTGTGAGTGG - Intergenic
900975873 1:6016000-6016022 TTAAATAAAAACATCTCTAGGGG - Intronic
901169715 1:7247758-7247780 TTAAGGACAAACATCTAGAGAGG + Intronic
902419521 1:16267603-16267625 TTAAAGCCAAACATTTTTTTGGG + Intronic
902537397 1:17127940-17127962 TTAAAATATAACAACTTTAGTGG + Intergenic
905109985 1:35588085-35588107 TTAAACTCAAACAGCTCCAGCGG - Intronic
908072178 1:60473323-60473345 TTAAAGTAAAACATGAATAGTGG - Intergenic
908081243 1:60580864-60580886 TTTAGGTCAAACTTCTTTATTGG + Intergenic
908775972 1:67640379-67640401 TTAAAGGGAAACATTTTTTGAGG - Intergenic
911757262 1:101572999-101573021 ATAAAGTAAAATATCTTTTGTGG + Intergenic
916644136 1:166765354-166765376 TTACAGTAAAACTTCTTTAAAGG - Intergenic
917184175 1:172334224-172334246 TTAAAGTCAAAAAATTTAAGTGG + Intronic
918256806 1:182756026-182756048 TAAAAGTAAAACATTTTTATGGG - Intergenic
919170879 1:193952555-193952577 TTAAAGTCAGTCATCAATAGTGG - Intergenic
921724686 1:218510830-218510852 TTAAAATCAAATAACTTTAGTGG + Intergenic
922988582 1:229886036-229886058 GTAAAGGAAAACATCATTAGGGG - Intergenic
923335606 1:232967174-232967196 ATAAATTCAAGCAACTTTAGAGG - Intronic
923900303 1:238319328-238319350 ATAAACTCAAACAACTTCAGGGG - Intergenic
924614649 1:245602733-245602755 TCGAAGGCAAACATCTTTGGAGG - Exonic
1063041658 10:2345771-2345793 TCAAAATCATACATCTTTAGTGG - Intergenic
1064636553 10:17374379-17374401 TTAAATGCAAACATTTTCAGAGG + Intronic
1064785660 10:18891821-18891843 TTAAAATCAAACGTTTTAAGAGG - Intergenic
1066193617 10:33078027-33078049 TCCAAGTCAATTATCTTTAGGGG + Intergenic
1066434831 10:35387816-35387838 TTAAAGTCACAGATCTTTGGTGG + Intronic
1067188320 10:44049072-44049094 TTAAAATGAAACATGTTTTGAGG + Intergenic
1068051744 10:51958836-51958858 ATAAAGTCAAACAATGTTAGAGG + Intronic
1069963786 10:72096521-72096543 TAAAAGGCAAACAACTTTAATGG + Exonic
1070191649 10:74116952-74116974 TTTAAGTCATACATCATTTGAGG - Intronic
1072270861 10:93774818-93774840 ATGAAATCAAACATATTTAGAGG + Intronic
1073723393 10:106201379-106201401 TTAAATTTAAAAATATTTAGAGG + Intergenic
1074928754 10:118101847-118101869 TTAAAGTCAAATATCTGCAAAGG - Intergenic
1075243174 10:120796937-120796959 TGAAATTAAACCATCTTTAGTGG - Intergenic
1075381599 10:122023382-122023404 TCAAACTCCAGCATCTTTAGGGG + Intronic
1075967839 10:126628210-126628232 TCAAAGCCAGAAATCTTTAGAGG - Intronic
1075997432 10:126889984-126890006 TTCAAGTCTAACATATTTGGAGG - Intergenic
1076169066 10:128305047-128305069 ATAAAATGAAACATATTTAGAGG - Intergenic
1077476859 11:2794565-2794587 TTAAGGTCCAGCATCTTTGGGGG - Intronic
1078435904 11:11325692-11325714 TTGAAGTAAAACATATATAGAGG - Intronic
1081223173 11:40488293-40488315 TTAAAGGAAAATATCTTCAGTGG + Intronic
1081754886 11:45537455-45537477 TGACAGTCACCCATCTTTAGGGG + Intergenic
1084867417 11:72070474-72070496 GTAAATTCAAACATCTTCAGGGG + Intronic
1086307240 11:85494726-85494748 TTAAAGCCAAAACTCTTTATTGG - Intronic
1086836229 11:91626400-91626422 TTAAAGTTAAAGAGGTTTAGAGG - Intergenic
1088073318 11:105816193-105816215 TTAAATACAAACAACTTTACAGG - Intronic
1090609596 11:128458390-128458412 AGAAAGTTGAACATCTTTAGTGG - Intergenic
1091726736 12:2851641-2851663 TTAAAATAAAACAAATTTAGCGG - Intronic
1092776276 12:11947411-11947433 TCAAAGTCAAACAGCTTGTGTGG + Intergenic
1093089715 12:14907654-14907676 TTAAAATCAGACATTTTGAGAGG + Intergenic
1093433805 12:19112663-19112685 TTAATGTTAATTATCTTTAGGGG - Intergenic
1094439495 12:30459075-30459097 TTAACTTAAAACATCTTTAAAGG - Intergenic
1095686777 12:45045327-45045349 TTAAATACAAAGATCTTTTGAGG - Intronic
1095795792 12:46217307-46217329 TCAAAGTCAAACATCCAGAGTGG + Intronic
1099338218 12:81392779-81392801 TTAAAGCAAAACATATTTGGGGG - Intronic
1099596968 12:84679226-84679248 ATAAAGTCACAAATCTTTAATGG + Intergenic
1101486906 12:105173676-105173698 GTAAAATCAAACATCTTTTGTGG + Intronic
1101554392 12:105794509-105794531 TCAAAGTCAAACAGCTGGAGTGG - Intergenic
1105522486 13:21143320-21143342 TTAAAATTATACATCTTTTGGGG - Intronic
1107196321 13:37656626-37656648 TTTAAGGCAAACTTCTCTAGAGG - Intronic
1108632331 13:52298318-52298340 TTAAAGTAAAACTACTTTATTGG + Intergenic
1108654370 13:52514275-52514297 TTAAAGTAAAACTACTTTATTGG - Intergenic
1108740808 13:53336253-53336275 TTAGAATCTAAGATCTTTAGAGG - Intergenic
1108779561 13:53812753-53812775 ATACAGTCAAACATCTTGAGTGG + Intergenic
1109415627 13:62035654-62035676 ATAAAGTTAAACATGTTTACAGG + Intergenic
1109776579 13:67048671-67048693 TTAAAGCCAAATAGCTTCAGAGG - Intronic
1110582602 13:77149132-77149154 CTATAGTCAAACATCTTGAAAGG + Intronic
1110686092 13:78376096-78376118 TAAAAGTCAAATATCTTAAAAGG - Intergenic
1110831768 13:80040067-80040089 TTCAAGTCAAGCATTTTTAAGGG + Intergenic
1111264391 13:85788875-85788897 TTATAATCAAACATATTTACAGG - Intergenic
1111953320 13:94728630-94728652 TTAAAAACAAACATCTTATGGGG - Intergenic
1112649153 13:101373336-101373358 TTAAATTGAAATATCTTTACCGG - Intronic
1112688874 13:101866146-101866168 TTTAACTCAAAAATCTTTAAAGG + Intronic
1114287448 14:21258492-21258514 CTAAAGTTAAACTGCTTTAGTGG - Intronic
1124701649 15:31918925-31918947 TAAAACTTAAACCTCTTTAGTGG + Intergenic
1124841822 15:33249300-33249322 TTAAAAACAAAAAGCTTTAGAGG - Intergenic
1124863525 15:33466891-33466913 TTCAATTCTAAGATCTTTAGGGG - Intronic
1126209189 15:46080556-46080578 TTAAAACCTAAAATCTTTAGAGG - Intergenic
1127238394 15:57082085-57082107 CTAAAGCCAATCATCTTTAAGGG - Intronic
1128000281 15:64185025-64185047 TTTAATTCAGACAACTTTAGAGG + Intronic
1130182109 15:81640542-81640564 AAAAAGTCAAAGCTCTTTAGAGG - Intergenic
1130829633 15:87585958-87585980 TTAAAGTCACATAGCTTGAGTGG - Intergenic
1131816549 15:96227125-96227147 ATAAAGTTTTACATCTTTAGAGG + Intergenic
1134360684 16:13528339-13528361 TTAAAATAAAACATCTTAATTGG - Intergenic
1141123306 16:81380315-81380337 TTAAATACAAATATCTTTGGGGG + Exonic
1144119726 17:12140126-12140148 TTAAAGTCAGAATTCTTTGGGGG - Intronic
1146023184 17:29296266-29296288 TTAAAGAAAAACCTCTTTGGGGG + Intergenic
1146608650 17:34285485-34285507 ATGAAGTTAAACATCTGTAGTGG - Intergenic
1149941596 17:60874385-60874407 TAAAAGACAAACATTTTTTGAGG + Intronic
1152949855 17:83222703-83222725 TTTAAGTCAAACATTGTGAGTGG + Intergenic
1153174577 18:2356716-2356738 TTAAAGTTAAACCTCCTTTGGGG + Intergenic
1153938858 18:9958812-9958834 CACAAGTCAAAAATCTTTAGTGG - Intronic
1154944228 18:21145904-21145926 TTAAGGTCAAATAGCTTTATGGG + Intergenic
1155585878 18:27364077-27364099 TTAAATGCAGACATTTTTAGTGG + Intergenic
1156183497 18:34634124-34634146 TGAAAGACAAACATCTCTAGAGG - Intronic
1157100683 18:44726069-44726091 TAAAAGTCAAAAAACTTCAGAGG - Intronic
1158174728 18:54642253-54642275 TTAAATCCAAACATTTTTAGAGG + Intergenic
1158317536 18:56228188-56228210 TTTAAGTGAAACCTCATTAGAGG - Intergenic
1159638700 18:70837850-70837872 TTATAGTGAAACATCTTCACGGG + Intergenic
1159820893 18:73142369-73142391 TTAATGTCAACCACCATTAGTGG - Intergenic
1164162103 19:22634074-22634096 TTAAAGGCAAACACCTTCTGCGG + Intergenic
1164748512 19:30633893-30633915 TTAAAATTAAAGATCCTTAGGGG - Intronic
1164817848 19:31219560-31219582 TCATAGCCATACATCTTTAGTGG - Intergenic
1168163096 19:54525620-54525642 TTAAAAACACACATCTTTAATGG - Intergenic
925024582 2:597744-597766 TTAAAGGCATACAACTTTAAGGG + Intergenic
925044508 2:761773-761795 CTAAAGTAAAACAGCTTTATTGG - Intergenic
926376776 2:12237433-12237455 TTAGAGTCAAAAATTTTAAGAGG + Intergenic
928160445 2:28919351-28919373 TTAAAGACAAAAATCTTTATAGG - Intronic
931547353 2:63403921-63403943 TGAAAGGCAAACATATTTATGGG + Intronic
932026740 2:68141294-68141316 TTAAAGTCAGACACCATTAATGG - Intronic
935467781 2:103419637-103419659 TTAAAAACAAGGATCTTTAGAGG + Intergenic
936084121 2:109455004-109455026 TTAATATAAAACATCTTTAGAGG - Intronic
936411777 2:112265221-112265243 TTAAAATCAAACATATTAATAGG + Intergenic
938199896 2:129363944-129363966 TTTAAGTCAAATATCATTATAGG - Intergenic
940098695 2:150008437-150008459 TTAAATTGAAAGTTCTTTAGAGG + Intergenic
940854333 2:158718019-158718041 TTAAAAACAAACATCTTAAAAGG + Intergenic
942435258 2:175965167-175965189 TTAGACTCAAACAACTTTAGAGG + Intronic
942565560 2:177262933-177262955 TTCAAGACAAACAACTTTAAAGG + Intronic
942748894 2:179265545-179265567 TTTAAGTCAGAAAACTTTAGTGG - Intergenic
943474979 2:188342734-188342756 TTTAAGTCTAAAATCTTTGGAGG - Intronic
945353541 2:208811421-208811443 TTTAAGTAAAACACCTTAAGTGG + Intronic
945694075 2:213080538-213080560 TTACAGTCATACATTATTAGAGG - Intronic
945814811 2:214591228-214591250 TTCAAGTCAAATATTTATAGTGG + Intergenic
947306293 2:228751614-228751636 TTTAAGACAATCATGTTTAGGGG + Intergenic
948963938 2:241361680-241361702 CTATAGTCAAACTGCTTTAGTGG + Intronic
1169111612 20:3037606-3037628 TTAAAGTCAGACCTCTTAACAGG - Intronic
1169888149 20:10424679-10424701 TTACAATCAAACATATTTTGGGG + Intronic
1170088885 20:12568049-12568071 TTAAACCCAAACATATTTAGAGG + Intergenic
1171306934 20:24114762-24114784 TAAAAATCAAATATCTCTAGAGG - Intergenic
1171942574 20:31346305-31346327 TTAAAGAAATACATCTTTGGAGG - Intergenic
1177056013 21:16301742-16301764 TTAAAGTAAAATATGCTTAGAGG + Intergenic
1178294693 21:31399724-31399746 TCAAAGTCAAAAATCTTAATGGG - Intronic
1178530358 21:33370843-33370865 TGAGAGTCAGACATCTTTAAAGG + Intergenic
1181404312 22:22671803-22671825 TTAAAGGATAACAGCTTTAGGGG - Intergenic
1181412908 22:22737380-22737402 TTAAAGGATAACAGCTTTAGGGG - Intronic
949394895 3:3604075-3604097 TTAAAGTCACAGTGCTTTAGGGG - Intergenic
951794080 3:26518314-26518336 TGAAAGTCAAAAATCTATTGGGG - Intergenic
953518568 3:43620989-43621011 TTAAAGTCATACAAATCTAGAGG - Intronic
954602658 3:51882034-51882056 TCAAAGTTAAACATTTTAAGTGG + Intergenic
955659578 3:61282496-61282518 TCAAAGTCACACATGTTTATTGG - Intergenic
955858967 3:63306333-63306355 TTAAATTCAAACATATTGAAAGG - Intronic
956505258 3:69930941-69930963 TCAAAATCAAATATCTTCAGTGG + Intronic
957446611 3:80320419-80320441 TTAAAGTCATACAAATTTAGAGG - Intergenic
957889015 3:86330537-86330559 TGAAAAACAAACACCTTTAGTGG - Intergenic
958711232 3:97719151-97719173 TTTAAGTTAAATATCTTTAAAGG - Intronic
959487228 3:106940794-106940816 TTAGATATAAACATCTTTAGGGG + Intergenic
959721052 3:109489766-109489788 TTAAACTAAAACAACTTTCGCGG - Intergenic
962637691 3:137347836-137347858 TTAAAGCCTCACAACTTTAGTGG + Intergenic
963725569 3:148916638-148916660 TTAAAGTAAAATATTATTAGAGG + Intergenic
965504804 3:169502708-169502730 TTAAAGTTCAACATCATTATAGG + Intronic
965842672 3:172925267-172925289 TTTAACTCAAACATTTTTTGGGG + Intronic
965993610 3:174850861-174850883 TTAAATTAAGACATCTTTAGTGG - Intronic
966479866 3:180394917-180394939 TTAAAGACAATAATTTTTAGAGG - Intergenic
970543965 4:17107871-17107893 TTAAAGTAAAACAGGTTCAGGGG + Intergenic
971834105 4:31739514-31739536 TTAAAGTCAAATATAATCAGAGG - Intergenic
973186181 4:47331848-47331870 TTCAAGACAAAAATCTGTAGAGG + Intronic
974256360 4:59459756-59459778 TTAAAATTAAACATCTTTATTGG + Intergenic
975630119 4:76392409-76392431 ATAAAGTTAAACATCTTTTCAGG + Intronic
976362906 4:84201355-84201377 TTAAAATCTGATATCTTTAGGGG + Intergenic
978449080 4:108809833-108809855 TTAAAATCATACATCCCTAGTGG - Intergenic
978956428 4:114618725-114618747 TTAAAGCTAAACATTTTTAATGG + Intronic
980254122 4:130354416-130354438 TTAAAGTAATACATATTTTGAGG - Intergenic
981111874 4:140944165-140944187 ATAAAATGAAACATCTTTTGTGG + Intronic
982278281 4:153658964-153658986 TCAAACTCAAACAGCTTTCGAGG - Intergenic
982335097 4:154227328-154227350 CTACAGTTAAATATCTTTAGTGG + Intergenic
983186167 4:164703227-164703249 TTAACTGCAAACAACTTTAGAGG - Intergenic
984245416 4:177269410-177269432 TTAAAGGCAAACATATATAAAGG - Intergenic
984318097 4:178155744-178155766 TTAAAAACAAATAGCTTTAGGGG + Intergenic
985323834 4:188744701-188744723 TTAATGGCAAACATTATTAGGGG - Intergenic
985950801 5:3220203-3220225 GTCCAGTCAAACATCTTCAGTGG + Intergenic
986494167 5:8325294-8325316 CTAAAGTCTAATATCTTTAATGG + Intergenic
987517751 5:18935501-18935523 TTAAAGTAAAGCATTTTTGGTGG - Intergenic
990148589 5:52790244-52790266 TTTTAGTCAAAAATCTTTGGTGG + Intronic
991065254 5:62417576-62417598 TCAGAGTCAAACATCTAAAGTGG - Intronic
993275682 5:85853876-85853898 TCAAAGTAAAACCTCTTTGGAGG + Intergenic
993788782 5:92179639-92179661 TTAAAAGCAAATATCTTTGGAGG - Intergenic
993803133 5:92369912-92369934 TTAAAGACAAACATCTGTTTTGG - Intergenic
994654016 5:102566369-102566391 ATAAATTCATACATCTATAGTGG - Intergenic
995513728 5:112933954-112933976 TTAGAGTTAAACACATTTAGAGG - Intergenic
997270772 5:132535905-132535927 TGAAACTCAGACATCTGTAGAGG + Intergenic
998728422 5:145045371-145045393 TTAAAGATAAACAGCTTCAGGGG - Intergenic
998929472 5:147165090-147165112 TTAAATTCAAACACCCTTTGAGG - Intergenic
999344354 5:150802289-150802311 TTAAAATCCCACATCATTAGGGG - Intergenic
1002744087 5:181456515-181456537 TTTAAGTCAAACATTGTGAGTGG + Intergenic
1004401867 6:15296115-15296137 TTAAAGGGAAACATCTTTTCTGG - Intronic
1004947201 6:20629239-20629261 TTCAAGTTATACATCTTTGGCGG + Intronic
1006066878 6:31468407-31468429 TGAATGTCAAACATCTCTGGAGG + Intergenic
1007894458 6:45338260-45338282 TGAAAGTATAACTTCTTTAGAGG - Intronic
1008951537 6:57165558-57165580 CTAAAATGAAAAATCTTTAGAGG - Intronic
1009482554 6:64177883-64177905 TTAAACTCTCACATCTTTAGGGG + Intronic
1010372686 6:75130015-75130037 GTGAAGTTAAACTTCTTTAGAGG - Intronic
1010405304 6:75498102-75498124 TTAAAATCCAACAGCTTTGGAGG + Intergenic
1011771382 6:90677237-90677259 TTAAAGTAAAAGATCTGTAGTGG - Intergenic
1012347734 6:98212236-98212258 TTAAAGTCACCCTTCATTAGTGG - Intergenic
1012769786 6:103417710-103417732 TTAAATTCACACATCTTTTTTGG + Intergenic
1013640230 6:112068524-112068546 TTAAAGTCAAACTATTTCAGAGG + Intronic
1013687165 6:112599004-112599026 TTAAAGACCAACATCTTAAGGGG + Intergenic
1014988716 6:128047245-128047267 CTGAAGTCAAAGATTTTTAGAGG + Intronic
1015876002 6:137822962-137822984 TTTAAGTCAAAAATCTTTCTTGG - Intergenic
1016113772 6:140258288-140258310 TTAAAGTAAATAATCTTTACTGG - Intergenic
1017398894 6:154036675-154036697 TGAAAATAAAACATCTTTATGGG - Intronic
1018122447 6:160649026-160649048 GAAAACTCAACCATCTTTAGAGG - Intronic
1018604508 6:165583454-165583476 TTACAGTTAAAGATCTTGAGAGG + Intronic
1019248946 6:170729744-170729766 TTTAAGTCAAACATTGTGAGTGG + Intergenic
1020917336 7:14211053-14211075 TCACAATCAAACATCTTTATAGG + Intronic
1021090807 7:16480454-16480476 TAAAATTCAAACTTCTTTGGAGG - Intronic
1022725968 7:32981971-32981993 TTAGAGTTAACCATCTTTATTGG + Intronic
1022758175 7:33317585-33317607 ACAAACTCAAACATCTTTAGGGG - Intronic
1025047630 7:55705682-55705704 TTAGAGTTAACCATCTTTATTGG - Intergenic
1027522596 7:79228829-79228851 TAAAAGTCCCAGATCTTTAGAGG + Intronic
1027658782 7:80964105-80964127 TTAAATTACAACATCTTTACAGG + Intergenic
1027904293 7:84160022-84160044 TTAAAATCAATCATATTTTGAGG - Intronic
1030452322 7:109728262-109728284 GTAGAGTAAAACAACTTTAGTGG + Intergenic
1031303030 7:120087697-120087719 TTAAAATCAAACATTTTAAGAGG + Intergenic
1031708475 7:125013310-125013332 TTCAACACAAACATCTTTTGAGG - Intergenic
1034451513 7:151139488-151139510 TAAATGTCAAACTTCATTAGAGG - Intronic
1035076621 7:156181968-156181990 TTAAAGTCAGACACATTCAGGGG - Intergenic
1035499101 8:77591-77613 TTTAAGTCAAACATTGTGAGTGG - Intronic
1035936105 8:3841625-3841647 TTCAGGTCACACATTTTTAGAGG + Intronic
1037020425 8:13963349-13963371 TTAATGTCCAACATCTTCATGGG + Intergenic
1037076099 8:14720801-14720823 TTATAGCCAAACATCTTGAAAGG + Intronic
1037321099 8:17643999-17644021 TTAATATAAAACATCTTTGGAGG - Exonic
1040468185 8:47714530-47714552 TAAAAGTCATACATGTCTAGTGG + Intronic
1040680356 8:49801477-49801499 TAAAAGTCACACAGCCTTAGAGG + Intergenic
1041415407 8:57602476-57602498 ATAAAGTGAAACTCCTTTAGAGG - Intergenic
1042435732 8:68762651-68762673 TTCAAAGCAAACATCTTTTGAGG - Intronic
1042696745 8:71561957-71561979 TTGAAGGCAAACATCTTGAATGG + Intronic
1043688082 8:83113658-83113680 TTAAAGTTAAACATAATTATAGG - Intergenic
1043851936 8:85225708-85225730 TTAAACTCAAACATTTTAACTGG + Intronic
1044492592 8:92837043-92837065 TTAAAGTCTATCTTCATTAGCGG + Intergenic
1045727242 8:105188315-105188337 TACAAGACAAACATCTTTGGAGG + Intronic
1049126896 8:140798273-140798295 TTAAAGTCAAACATCTTTAGTGG - Intronic
1052207318 9:25858182-25858204 TTAAAAGCAAAAATCTTTAAAGG + Intergenic
1055804937 9:80082179-80082201 ATAAAGTGAAACCTCATTAGAGG - Intergenic
1058051278 9:100409482-100409504 TTAAAGACCAAAATCCTTAGTGG - Intergenic
1059549781 9:115217264-115217286 TTAAGTTCAAACAACTTCAGTGG + Intronic
1059993644 9:119888807-119888829 TTACAGGCAAACACCTTTAAGGG + Intergenic
1062147970 9:135000930-135000952 TTAAATTCAAACATTTTTTATGG + Intergenic
1203609901 Un_KI270748v1:87008-87030 TTTAAGTCAAACATTGTGAGTGG + Intergenic
1186884727 X:13901899-13901921 TTAAAATAAAACAACATTAGAGG - Intronic
1187897347 X:23994999-23995021 TTAAAGTAAAAGATGTTTAGAGG - Intronic
1188639569 X:32483582-32483604 TTAAAGTTAAATACATTTAGTGG - Intronic
1189138470 X:38575777-38575799 ATAAAGTCAAACAGTTGTAGTGG + Intronic
1190304921 X:49076450-49076472 TCAAACTCAAACAGCTTTCGGGG + Exonic
1196002667 X:110803420-110803442 TCAAACTCATACATCTCTAGGGG - Intergenic
1197453156 X:126642767-126642789 TTAAAGTCAATTATCTGAAGTGG + Intergenic
1198446240 X:136717837-136717859 TTTAAGAAAAACATTTTTAGTGG - Intronic
1198680129 X:139172574-139172596 CTAAAGACAAAAATCTTTAAAGG + Intronic
1201424823 Y:13836797-13836819 TTCAAGGCAAAAATATTTAGTGG - Intergenic