ID: 1049126899

View in Genome Browser
Species Human (GRCh38)
Location 8:140798310-140798332
Sequence GGCAATGTATCTTCACCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049126896_1049126899 14 Left 1049126896 8:140798273-140798295 CCACTAAAGATGTTTGACTTTAA 0: 1
1: 0
2: 0
3: 21
4: 226
Right 1049126899 8:140798310-140798332 GGCAATGTATCTTCACCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049126899 Original CRISPR GGCAATGTATCTTCACCTTA GGG Intronic
No off target data available for this crispr