ID: 1049127175

View in Genome Browser
Species Human (GRCh38)
Location 8:140802011-140802033
Sequence CTGGATAATGACTATGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049127173_1049127175 25 Left 1049127173 8:140801963-140801985 CCAGTCTTATAAAAGTATAGCAC 0: 5
1: 71
2: 254
3: 376
4: 467
Right 1049127175 8:140802011-140802033 CTGGATAATGACTATGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049127175 Original CRISPR CTGGATAATGACTATGTTAC TGG Intronic
No off target data available for this crispr