ID: 1049127316

View in Genome Browser
Species Human (GRCh38)
Location 8:140803783-140803805
Sequence GATTCTCCATGCTGCCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049127313_1049127316 7 Left 1049127313 8:140803753-140803775 CCTAAGACTGGAGGTCTGGGGAA 0: 1
1: 0
2: 0
3: 22
4: 234
Right 1049127316 8:140803783-140803805 GATTCTCCATGCTGCCCCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 239
1049127305_1049127316 22 Left 1049127305 8:140803738-140803760 CCTGAAGACATCCTCCCTAAGAC 0: 1
1: 0
2: 0
3: 13
4: 135
Right 1049127316 8:140803783-140803805 GATTCTCCATGCTGCCCCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 239
1049127308_1049127316 11 Left 1049127308 8:140803749-140803771 CCTCCCTAAGACTGGAGGTCTGG 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1049127316 8:140803783-140803805 GATTCTCCATGCTGCCCCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 239
1049127312_1049127316 8 Left 1049127312 8:140803752-140803774 CCCTAAGACTGGAGGTCTGGGGA 0: 1
1: 0
2: 0
3: 10
4: 160
Right 1049127316 8:140803783-140803805 GATTCTCCATGCTGCCCCAGGGG 0: 1
1: 0
2: 1
3: 22
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049127316 Original CRISPR GATTCTCCATGCTGCCCCAG GGG Intronic