ID: 1049130216

View in Genome Browser
Species Human (GRCh38)
Location 8:140832814-140832836
Sequence GTGCACGTACACCTTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 77}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049130216_1049130221 4 Left 1049130216 8:140832814-140832836 CCATGGGCAAGGTGTACGTGCAC 0: 1
1: 0
2: 0
3: 12
4: 77
Right 1049130221 8:140832841-140832863 TTCTAGTAGGGATTTCAAGAAGG No data
1049130216_1049130222 11 Left 1049130216 8:140832814-140832836 CCATGGGCAAGGTGTACGTGCAC 0: 1
1: 0
2: 0
3: 12
4: 77
Right 1049130222 8:140832848-140832870 AGGGATTTCAAGAAGGCAACTGG No data
1049130216_1049130218 -8 Left 1049130216 8:140832814-140832836 CCATGGGCAAGGTGTACGTGCAC 0: 1
1: 0
2: 0
3: 12
4: 77
Right 1049130218 8:140832829-140832851 ACGTGCACGCCCTTCTAGTAGGG No data
1049130216_1049130217 -9 Left 1049130216 8:140832814-140832836 CCATGGGCAAGGTGTACGTGCAC 0: 1
1: 0
2: 0
3: 12
4: 77
Right 1049130217 8:140832828-140832850 TACGTGCACGCCCTTCTAGTAGG No data
1049130216_1049130223 27 Left 1049130216 8:140832814-140832836 CCATGGGCAAGGTGTACGTGCAC 0: 1
1: 0
2: 0
3: 12
4: 77
Right 1049130223 8:140832864-140832886 CAACTGGCCATGTTTCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049130216 Original CRISPR GTGCACGTACACCTTGCCCA TGG (reversed) Intronic
900310451 1:2030889-2030911 TTGAACATACACCTTGCCCAGGG + Intergenic
900581266 1:3410856-3410878 GAGCAGGTTCACCTTCCCCAGGG + Intronic
903918339 1:26780617-26780639 GTTCTCGTCCACCTTGGCCAAGG - Exonic
905384697 1:37594203-37594225 GTGGTCAGACACCTTGCCCAAGG + Intronic
906719567 1:47995853-47995875 CTGGAGGTGCACCTTGCCCAAGG + Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
908144760 1:61228312-61228334 GTGCAACTCCACCTTGCTCACGG - Intronic
910356594 1:86364308-86364330 GTGTACATACAGGTTGCCCAGGG - Intronic
924440583 1:244082292-244082314 GAGCAGGTACCCCTTACCCAGGG + Intergenic
1062841247 10:673627-673649 GTGCCCATACTCCTTCCCCAGGG + Intronic
1073574276 10:104608676-104608698 GTGCAAGGACACATGGCCCAAGG + Intergenic
1074962901 10:118463954-118463976 GTGGACAGCCACCTTGCCCAAGG - Intergenic
1075090538 10:119441909-119441931 GAGCTCGTATGCCTTGCCCAAGG + Intronic
1077236115 11:1482736-1482758 GTGCCCGTCCACCTGCCCCATGG - Intronic
1079134309 11:17767797-17767819 GTGCAAAGACACCTTCCCCAGGG - Intronic
1081310547 11:41566088-41566110 GTGCACGTGCACCTTTCTCAAGG - Intergenic
1082028827 11:47590643-47590665 GTTCACGTACACCTTGTCGAAGG + Exonic
1083680285 11:64348575-64348597 CTGCACCTAGGCCTTGCCCAAGG - Intronic
1085859435 11:80214688-80214710 GTGCTAGTACACACTGCCCAGGG + Intergenic
1089963831 11:122638932-122638954 GTGGCCGCACACCTTCCCCAGGG + Intergenic
1097248511 12:57619852-57619874 GGGCACGTGCACGATGCCCACGG - Intronic
1099500234 12:83405047-83405069 GTGCACGTGCACATTCACCATGG + Intergenic
1104035832 12:125096570-125096592 GTGCAGGGATACCTTGTCCAGGG + Intronic
1104903572 12:132201952-132201974 GAGCACCTGCACCCTGCCCAGGG + Intronic
1105957205 13:25295138-25295160 GAGGAGGTACACCTGGCCCAAGG + Intergenic
1107238567 13:38202831-38202853 GGCCACGTACACCTTGCTCTTGG - Intergenic
1111120323 13:83840179-83840201 ATGCACGTTAACATTGCCCAGGG - Intergenic
1112697139 13:101962902-101962924 TTGCACCTGCACCTTGCACATGG + Intronic
1120952321 14:90052801-90052823 GTGCACGGACACCTGGCCTCAGG - Intergenic
1121187470 14:91987945-91987967 GTTCACGTGCATCTTGCCTAAGG - Intronic
1123689709 15:22827821-22827843 GTGCACGGACACCTGGTCCGTGG + Exonic
1125265915 15:37880761-37880783 GTGCACGTACACACTACCCCCGG + Intergenic
1127713340 15:61623672-61623694 CTGCACTTCCACCTTGCCCAAGG + Intergenic
1131065354 15:89431161-89431183 GTGCACGCACACCTGTCTCAGGG + Intergenic
1131121161 15:89824104-89824126 CTGCCCCTACACCTTGGCCAAGG + Intergenic
1133713081 16:8420269-8420291 GTGCACGTGCATCTTGCGAAAGG + Intergenic
1136418953 16:30120531-30120553 GTGGACTTGCACCTTGCCCAGGG - Intronic
1152815208 17:82403883-82403905 GGGCACGCTCACCTTGTCCACGG + Intronic
1152815212 17:82403904-82403926 GGGCACGCTCACCCTGCCCACGG + Intronic
1153304035 18:3616339-3616361 GTACATGTACACATCGCCCAGGG - Intronic
1157114889 18:44853194-44853216 GGCCACTTACAACTTGCCCATGG + Intronic
1157393570 18:47323449-47323471 GTTCAGGTACACATTGTCCAGGG + Intergenic
1161501745 19:4620050-4620072 GTGCCAGAACACCTGGCCCAGGG + Intergenic
1167326797 19:48831667-48831689 GGGGACGTACACCTTGACCAAGG - Exonic
928908301 2:36391617-36391639 CTGCAGGTACACCTAGGCCAAGG - Intronic
929762886 2:44820705-44820727 TTGTATGTACACCATGCCCAGGG - Intergenic
943755281 2:191550755-191550777 GTGCAAGGACACCTTGGCCTTGG + Intergenic
946103973 2:217353095-217353117 GTGGTCATCCACCTTGCCCAGGG + Intronic
1171371511 20:24665356-24665378 GTGCAAGTCCCCCTTGGCCACGG - Exonic
1181668963 22:24416911-24416933 CTGCACGCAAACCTTCCCCAAGG - Exonic
1184231221 22:43159414-43159436 GTGCACGCCCACCTACCCCATGG - Exonic
950964948 3:17139633-17139655 GTGCCCGTCCACCCAGCCCACGG + Intergenic
953184317 3:40624219-40624241 GTGCAGGTGTATCTTGCCCAGGG + Intergenic
961002559 3:123383811-123383833 GTGCACGTGCACCTTGAGGAAGG - Intronic
962384511 3:134922026-134922048 GAGCACGTACTCAGTGCCCAAGG - Intronic
962716791 3:138133420-138133442 GTGCTCCTGCTCCTTGCCCAGGG + Intergenic
963962451 3:151324122-151324144 GTAAACATACACCTTGCCCATGG - Intronic
969910408 4:10439522-10439544 GTGCAAGTACACGTGGTCCAGGG + Intergenic
975736965 4:77390198-77390220 GTTCACCTCCACCTTGCCCAAGG + Intronic
985034047 4:185820601-185820623 GTGCGCGGACACCTTGCCTGCGG + Intronic
988244509 5:28662091-28662113 TTCCACATACACCTTGCCAATGG - Intergenic
994889543 5:105613492-105613514 GTGCACACACACATTGCTCATGG - Intergenic
996635545 5:125684945-125684967 GGGCAAGTACAACTTGGCCATGG - Intergenic
997130450 5:131271154-131271176 TTGCAGGTTCACTTTGCCCAGGG + Intronic
1002614774 5:180444566-180444588 TTGCACGTCATCCTTGCCCAGGG - Intergenic
1004415699 6:15422327-15422349 GTGCATATTCACCTTTCCCATGG + Intronic
1009914028 6:69970089-69970111 CTGCACGGACACATTGCCTAGGG + Intronic
1011403354 6:86989105-86989127 ATGCACATACCCCTTACCCAAGG + Intronic
1017206382 6:151808025-151808047 GTCCAGGTACACCTCGCCCAGGG - Exonic
1019192034 6:170257339-170257361 GTACAGCTACACCTTGCACACGG - Intergenic
1020174185 7:5869253-5869275 GTGAACATACCCCTTCCCCAAGG + Intergenic
1022958040 7:35399287-35399309 GTGCACATAAACTTGGCCCAGGG - Intergenic
1023340491 7:39214237-39214259 TTGCACGTACTCCTAGCCCAGGG + Intronic
1024088239 7:45914844-45914866 GTGCACGTCCTCCTTCCCCTTGG + Exonic
1025986751 7:66459883-66459905 GTGCACCTAAACCTTAGCCAGGG - Intergenic
1026003275 7:66580131-66580153 GTGCATGTAAACCTTAGCCAGGG - Intergenic
1026028264 7:66765537-66765559 GTGCACGTAAACCTTAGCCAGGG + Intronic
1029084572 7:98001118-98001140 GTGAACCTACCCCTTCCCCAAGG - Intergenic
1031629763 7:124032674-124032696 CTGCAGGTACACCTTCTCCAGGG + Exonic
1034273956 7:149816024-149816046 GTGCTCGTCCTCCCTGCCCAGGG + Intergenic
1047667094 8:127104097-127104119 GAGCACTTACACCATGCTCATGG + Intergenic
1049130216 8:140832814-140832836 GTGCACGTACACCTTGCCCATGG - Intronic
1055812146 9:80161716-80161738 CTGCATCTACACCTTGACCATGG + Intergenic
1058870335 9:109196225-109196247 TTGCATGTCCACCTTGCGCAGGG + Intronic
1060088440 9:120721866-120721888 TTTCACGTTCATCTTGCCCAGGG - Intergenic
1061049544 9:128186290-128186312 GTGGAGGTGCAGCTTGCCCAGGG + Intronic
1061800690 9:133112075-133112097 GTGCAGCTGCACCTTGCGCAGGG + Exonic
1062257991 9:135639390-135639412 GTGCACGTGCAGCTGACCCACGG - Exonic
1197281649 X:124543786-124543808 GTGAACGTGCACCCTGCCCATGG - Intronic
1200091914 X:153640012-153640034 GTGCCCCTCCACCTTGCCCGGGG + Intergenic