ID: 1049134730

View in Genome Browser
Species Human (GRCh38)
Location 8:140885907-140885929
Sequence TCATCTCTCCAGGATCATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049134727_1049134730 13 Left 1049134727 8:140885871-140885893 CCGGGTTCTGAGTGGAGGAGTGA 0: 1
1: 0
2: 4
3: 18
4: 179
Right 1049134730 8:140885907-140885929 TCATCTCTCCAGGATCATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049134730 Original CRISPR TCATCTCTCCAGGATCATTC TGG Intronic
No off target data available for this crispr