ID: 1049139232

View in Genome Browser
Species Human (GRCh38)
Location 8:140936641-140936663
Sequence ATTTGCTGGTGGAGGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 323}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049139232_1049139238 29 Left 1049139232 8:140936641-140936663 CCTTCACACCTCCACCAGCAAAT 0: 1
1: 0
2: 3
3: 32
4: 323
Right 1049139238 8:140936693-140936715 ACACATCACATCAGACACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049139232 Original CRISPR ATTTGCTGGTGGAGGTGTGA AGG (reversed) Intronic
900209807 1:1449547-1449569 ATATGCTGGTCGAGGTGTCGAGG - Intergenic
900857455 1:5197408-5197430 ATTTGGTGGGGGAGGGGGGATGG + Intergenic
901094285 1:6665861-6665883 ATTGGCAGATGGAGGTGGGATGG - Intronic
902371112 1:16007321-16007343 AGTTACTGGTGTGGGTGTGAAGG + Exonic
904332370 1:29768519-29768541 AGATGCTGAAGGAGGTGTGAGGG + Intergenic
905949922 1:41941484-41941506 ATTTGGTGGTGGAAGTATGAGGG + Intronic
906532503 1:46531814-46531836 ACATGCATGTGGAGGTGTGAGGG - Intergenic
906922596 1:50080579-50080601 ATTTTCTGATGGAGATGTCAGGG - Intronic
907363717 1:53943586-53943608 ATTTGGCGGTGGAAATGTGAGGG + Intronic
907822810 1:57987762-57987784 ATTTGCTGGTGAAGGAGTTGGGG + Intronic
908368457 1:63453389-63453411 CTTTGCTTATTGAGGTGTGAAGG + Intronic
909159838 1:72132529-72132551 ATGTGATGGTGAAGATGTGATGG + Intronic
909375766 1:74939960-74939982 TTTTGCTGATGCAGGTGGGAAGG - Intergenic
910186732 1:84549518-84549540 ATTTGGTGGTGGTGGCGGGAGGG + Intergenic
914915377 1:151816121-151816143 CTGTGGTGGTGGAGGTGTGCAGG + Intronic
915355630 1:155254031-155254053 ACTGGCTGGGGGAGGTGTGCAGG - Intronic
917170917 1:172173075-172173097 TTATTCTGGTAGAGGTGTGAAGG + Intronic
918617316 1:186560319-186560341 ATTTGGTGGTGGTGGTGTTATGG + Intergenic
919134546 1:193491414-193491436 ATTTGGTGGTGGGGGTGACAAGG - Intergenic
919364620 1:196641944-196641966 AAGTGCTGGTGGTTGTGTGAGGG + Intergenic
919609634 1:199729312-199729334 TTTTTTTGGTGGAGGTTTGAGGG - Intergenic
920567920 1:206990564-206990586 GATTGCTGGTGCAGGGGTGAAGG - Intergenic
920777833 1:208957650-208957672 GTTTTCTGGTGGAGTTGTTAGGG - Intergenic
920793642 1:209117079-209117101 ATTTCCAGGTGGAGGTGAGAGGG + Intergenic
921359079 1:214313808-214313830 ATTTGCTGCTGGAAGGGTGGAGG - Intronic
924645004 1:245869700-245869722 ATTTTGGGGTGGAGCTGTGAGGG - Intronic
1063071044 10:2664654-2664676 CTTTGCTGGTGGGGTGGTGACGG - Intergenic
1063685290 10:8231226-8231248 TTTTGCTGGTGCAGGTGACAGGG + Intergenic
1064934204 10:20662143-20662165 ATCTGATGGTCGAGGTGCGATGG - Intergenic
1065194187 10:23246195-23246217 ATTTGAGGGTGGAGGTTTGGAGG + Intergenic
1066304064 10:34122237-34122259 AGCTGCTTGTGGAGATGTGAAGG + Intronic
1066355121 10:34676005-34676027 CATTGCTGCTGGCGGTGTGATGG - Intronic
1067320405 10:45214900-45214922 ATTTGGTGGTGGTGGTGTTTTGG - Intergenic
1067739176 10:48881771-48881793 CCTGGCTGGTGGAGGTGTGAGGG - Intronic
1067947752 10:50701167-50701189 GTTTCCTGGTGGAGGTGGAAGGG - Intergenic
1068072244 10:52209751-52209773 ATTTGCTGATGGATTTGAGATGG - Intronic
1068213289 10:53951314-53951336 ATTTTTTGGTGGGGGTGGGAGGG - Intronic
1068244306 10:54343639-54343661 ATTTGCGGGGGGAGGTGGGAGGG + Intronic
1068948055 10:62749262-62749284 ATTTGCTAGAGGAGATCTGAGGG - Intergenic
1069291870 10:66789964-66789986 AATTGCTGATGGAGGAGTGAAGG + Intronic
1070778589 10:79124701-79124723 ACTTCCTGGTGGAGGGGTAAGGG + Intronic
1070883068 10:79866160-79866182 ATTTCCTGGTGGAGGTGGAAGGG - Intergenic
1071649636 10:87382475-87382497 GTTTCCTGGTGGAGGTGGAAGGG - Intergenic
1073495374 10:103885942-103885964 GGTTTCTGGTGGAGGTATGATGG - Intronic
1073654680 10:105400146-105400168 ATGTGGTGGTGAAGTTGTGAGGG - Intergenic
1073700913 10:105925683-105925705 CTGTGCTGGTGGAGGTGGCAGGG - Intergenic
1073765372 10:106676547-106676569 ATATACTGGTGAGGGTGTGAGGG + Intronic
1074088747 10:110227385-110227407 AGGTGCTGGGGGAGGTGCGAGGG + Intronic
1074390088 10:113049862-113049884 TTGTGCTGGTGGAGGAGAGATGG + Intronic
1074758278 10:116644197-116644219 ATGTGCGGGTGGAGGGATGATGG - Intronic
1078093567 11:8282899-8282921 AGCTGGTGGTGGCGGTGTGACGG - Intergenic
1078967979 11:16369912-16369934 TTTTGCTGCTGGAGGGATGATGG - Intronic
1080866640 11:36201109-36201131 ATTTGAAGGTAGAAGTGTGATGG + Intronic
1081227344 11:40540559-40540581 CTCTGCAGGTGGAGGTGTCAGGG - Intronic
1082106114 11:48223579-48223601 ATGTGCTGGTGGGGATATGAAGG + Intergenic
1084884655 11:72195778-72195800 ATTTGGAAGTGGAGGTGTGTGGG + Intronic
1084959356 11:72708194-72708216 CATCGCTGCTGGAGGTGTGATGG + Intronic
1085152135 11:74260811-74260833 ATGTGCATATGGAGGTGTGAAGG - Intronic
1085207620 11:74746078-74746100 CATTGCTGCTGGAGGTGTAATGG - Intergenic
1086100570 11:83095013-83095035 CTTTGCTGGTGGAGGAGTTAAGG + Intergenic
1086666053 11:89483593-89483615 AGGTGCTGGTGGGGGTGGGAGGG + Intronic
1086932221 11:92705541-92705563 GTGTGATGGTGGTGGTGTGATGG + Intronic
1086932235 11:92705605-92705627 ATGTGGTGGTGGTGGTGTGATGG + Intronic
1086932297 11:92705913-92705935 GTTTGATGGTGGTGGTGTGATGG + Intronic
1087182800 11:95156365-95156387 ATGAGCTGGTGGAGGAGAGATGG - Intergenic
1088678379 11:112218340-112218362 CATTGCTGCTGGAGGTGTCATGG + Exonic
1091631966 12:2168829-2168851 AGATGCTGGTGGTGGTGTGATGG + Intronic
1091730318 12:2876239-2876261 ATTTGAAGGTAGAGGTGTGGAGG - Intronic
1091757297 12:3062404-3062426 ATCTGCAAGTGGAGGTTTGAAGG - Intergenic
1092177067 12:6417307-6417329 AATTGCTGGTGCAAGTGTGTGGG + Intergenic
1094880289 12:34717216-34717238 ATTTGCAGTTGGAGATTTGAAGG - Intergenic
1094883547 12:34833695-34833717 ATTTGCAGGTGGAGATTTCAAGG - Intergenic
1094883804 12:34837937-34837959 ATTTGCCGGTGGAGATTTCAAGG + Intergenic
1094900961 12:35116154-35116176 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094905391 12:35187481-35187503 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094919605 12:35417435-35417457 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094941799 12:35777272-35777294 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1094989644 12:36551163-36551185 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1095007764 12:36844378-36844400 ATTTGCAGGTGGAGATTTCAAGG + Intergenic
1098057897 12:66527801-66527823 ATTTGAGGGTGGAGGTTGGAGGG + Intronic
1099094165 12:78352551-78352573 ACTTGCTGTAGAAGGTGTGAAGG + Intergenic
1100246419 12:92762326-92762348 ATTTGGAGGTGGAGGAGAGAGGG + Intronic
1103425740 12:120831819-120831841 CTTTGGTGGTAGTGGTGTGAGGG - Intronic
1104186503 12:126437082-126437104 ATTTGCTGGTGGGGTTGTTAGGG + Intergenic
1104738279 12:131153400-131153422 ATCTGCTGGAGGAGATGTGAGGG - Intergenic
1104794434 12:131507397-131507419 ATCTGCTGGAGGAGATGTGACGG + Intergenic
1105516386 13:21094678-21094700 CATTGCTGCTGGAGGTGTAATGG - Intergenic
1105843582 13:24275931-24275953 ATTTTTTGGGGGAGGGGTGAGGG - Intronic
1106297492 13:28429886-28429908 CTTGGGTGGTGGAGGTGAGAAGG - Intronic
1107855907 13:44615271-44615293 ATCAGATGGTGGAAGTGTGAGGG + Intergenic
1108732681 13:53251292-53251314 ATTTCCTGCAGGAGGTGGGAAGG - Intergenic
1111770011 13:92585002-92585024 GTTTGCTGGTGGAGGGGGTAAGG + Intronic
1112097388 13:96149932-96149954 AATTGCTAGTGGTGGTGTTACGG + Intronic
1114881943 14:26797049-26797071 ATTTGCTGATGCAGTTATGAAGG - Intergenic
1115025982 14:28746817-28746839 AATTGCTGGAGGAAGTGAGATGG - Intergenic
1115627267 14:35206273-35206295 ATTAGCTGGGAGAGGAGTGAGGG + Intronic
1116593223 14:46807070-46807092 ATTAACTGGTGGAGGAGAGATGG - Intergenic
1121086807 14:91152943-91152965 GTGGGCTGGTGGAGCTGTGAGGG + Intronic
1121509208 14:94499971-94499993 TTTTGCTGGTGCTGCTGTGAGGG - Intronic
1122550653 14:102547486-102547508 ATTTGCTGCTGTAGGACTGAGGG + Intergenic
1122757948 14:103997511-103997533 ATGTTCAGGTGGAGGTGTCATGG + Intronic
1123824610 15:24068689-24068711 AGTGGCTTGTGGGGGTGTGAAGG - Intergenic
1124206031 15:27721360-27721382 ATTTTCTTGTGGAGGGGTGCAGG - Intergenic
1124940646 15:34214325-34214347 AGTTGCTGGTGGAGGTGGTGGGG + Intergenic
1127474101 15:59316100-59316122 TTTTGCAAGTGGAGGTTTGATGG - Intronic
1127571893 15:60251653-60251675 ATTAGCTTGAGCAGGTGTGAAGG - Intergenic
1128378387 15:67093424-67093446 ATTTGCCAGTGGAGGTAGGAAGG + Intronic
1129123978 15:73422095-73422117 AAGTGGTGGTGGAGGTGAGAAGG + Intergenic
1131291700 15:91112113-91112135 ATTGGCTGGGGGTGGGGTGAGGG + Intronic
1133525646 16:6602837-6602859 ATGTGATGGTGGGGGTGTGTGGG - Intronic
1134084968 16:11349964-11349986 ATGTGCTGGAGGAGGTGGCAGGG + Intronic
1134212815 16:12292046-12292068 ATCTGCTGGTGGAGGGGTTGTGG + Intronic
1134238741 16:12488319-12488341 ACTTCCTGGTGGAGGTATGAAGG - Intronic
1135164170 16:20124176-20124198 ATTTGCTGCTGATGCTGTGATGG + Intergenic
1135832835 16:25792405-25792427 ATTTGCTGATGAAGCTGTCAGGG + Intronic
1138140555 16:54564799-54564821 ATGAGCTGGTGGAAATGTGAAGG - Intergenic
1139628263 16:68209476-68209498 TGTTGCTGCTGGAGGTGTGGTGG + Intronic
1139836717 16:69844953-69844975 CTTTGCTGTTGCAGGTATGAAGG + Intronic
1142028881 16:87828688-87828710 AGATGCTGGTGCAGGTGTGTTGG + Intergenic
1142041374 16:87896596-87896618 CTTTGCTGGTGGAAGTGGGTTGG + Intronic
1142219755 16:88848292-88848314 ATTCGCTGGTGAAAGTGTGCGGG - Intronic
1143729428 17:8872565-8872587 TTTTGCTGGTGGAGCTGAGCTGG + Intergenic
1144022237 17:11247602-11247624 ATTGGTTGGTGGTGGTGGGAGGG + Intronic
1144385109 17:14742040-14742062 CTTTGGTGGTGGTGGTGGGAGGG + Intergenic
1146291399 17:31610106-31610128 ATTTGCTTGTGGAGGAGTTTTGG + Intergenic
1146506406 17:33409575-33409597 AATTGGTGGTGGAGGGGTGAGGG - Intronic
1146736902 17:35245983-35246005 AGTTGTTGGTGAAGATGTGAAGG - Intronic
1148487890 17:48003110-48003132 ATTTGCTGCTGTGGGGGTGAGGG + Intergenic
1150580210 17:66466434-66466456 ACTTGCTTGTGGAGCTGAGATGG + Intronic
1150626593 17:66845598-66845620 GTTGGCTGATGGAGGTGTGCTGG - Intronic
1151585297 17:75004898-75004920 GTTAGTTGGTGGCGGTGTGAAGG - Exonic
1152450115 17:80373273-80373295 ATGTGGTGGGGAAGGTGTGAGGG - Intronic
1154238800 18:12632348-12632370 ATTTGGTGGTGGTGGTGTGAGGG - Intronic
1156515219 18:37673622-37673644 ATCTCCTGGTGGAGCTGTGGGGG + Intergenic
1157212956 18:45759616-45759638 GCTTCCTGGAGGAGGTGTGAAGG + Intergenic
1157814956 18:50723573-50723595 ATTTTCTGGGGCAGGTGTGGTGG + Intronic
1160183088 18:76652911-76652933 ATTTGTTGGTGTAGGTATCAGGG + Intergenic
1160393031 18:78549260-78549282 GTGTGCAGGTGTAGGTGTGAGGG - Intergenic
1161193624 19:2973779-2973801 ATTAGCTGGAGGTGGTGTGGTGG + Intergenic
1161340826 19:3741148-3741170 ATTAGCTGGGGGCGGGGTGATGG - Intronic
1162039115 19:7958551-7958573 ATGTGCTGGTGTAGGGGTGATGG - Intergenic
1162580004 19:11523450-11523472 CATTGCTGCTGGAGGTGTAATGG + Intronic
1164794619 19:31015713-31015735 TTTTCCTGGTGGAGCTGTGTGGG + Intergenic
1165769349 19:38369743-38369765 ATTGACAGATGGAGGTGTGAAGG + Intronic
1167001867 19:46750280-46750302 ACCTGCTGGTGAGGGTGTGAGGG - Intronic
1167050661 19:47075914-47075936 CTTTGCTGGTGGAGGGGCCAGGG - Intronic
1167596196 19:50429377-50429399 ACTTGGTGGTGGAGGTGTGAGGG + Exonic
1168420559 19:56199776-56199798 TTTTACTGGTGGAGGTTTCAGGG + Intergenic
1168441481 19:56371469-56371491 ATTTGTTTGTGGAGGCGTGGGGG - Intergenic
924998293 2:384102-384124 AGTTGCAGGTGCAGGTGGGAGGG + Intergenic
926856501 2:17262217-17262239 ATTTTCTGGTGGAGGAGGGGAGG - Intergenic
929426586 2:41850565-41850587 CATTGCTGTTGGAGGTGTAATGG - Intergenic
930003363 2:46876880-46876902 CAGTGCTGGTGCAGGTGTGAGGG - Intergenic
930056034 2:47252733-47252755 ACTTACTGGTGGTGGTGTTAGGG + Intergenic
931567422 2:63629272-63629294 ATTTGCTGGTGTAGCTAAGATGG - Intronic
931881347 2:66574404-66574426 ATTTGGTGGTGGGGGGGTGGGGG + Intergenic
932262276 2:70336892-70336914 CTTTGCTGGTGGGTGAGTGAGGG + Intergenic
932590536 2:73064080-73064102 GCTGGCTGGTGGAGGTGGGAAGG - Intronic
932703281 2:74004860-74004882 ATGTGCTGTTGGAGGGGTGTGGG + Intronic
932863489 2:75318013-75318035 ATTTACTGGGGGAGATGTAAGGG + Intergenic
933313217 2:80686172-80686194 ATTCTCTGGTGGAGGTCTGGGGG - Intergenic
933597819 2:84300516-84300538 ATTTGGTGGAGGCGGTGGGATGG - Intergenic
933658720 2:84909326-84909348 GTGTGGTGGTGGAGGTGTGATGG - Intergenic
933658774 2:84909605-84909627 GTGTGGTGGTTGAGGTGTGATGG - Intergenic
938293847 2:130164582-130164604 ATTTTTTGGTGATGGTGTGAAGG - Intronic
938911375 2:135888554-135888576 AATTGCTGCTGGAGGTTGGAAGG + Intergenic
939676553 2:145079475-145079497 ATCTGCTGCTGGGGGTGGGAAGG - Intergenic
941961753 2:171260873-171260895 ACTTGGGGGTGGAGGAGTGAGGG + Intergenic
942189056 2:173453286-173453308 ACTTCCTGCTGGGGGTGTGATGG + Intergenic
943085975 2:183311697-183311719 ATTTGCTTTTGGAAGTGTGTTGG + Intergenic
943936378 2:193921241-193921263 ATTTGAGGGTGGAGGTTAGAAGG + Intergenic
946103650 2:217350885-217350907 CTGTGCTGGTGGGGGTGTCAAGG + Intronic
946889531 2:224260900-224260922 ATTTGCTGGTGGAAGTAGGGTGG - Intergenic
948356105 2:237378657-237378679 ATATGTTAGTGGAGGTGTGGAGG - Exonic
948966370 2:241383726-241383748 ATTTGCTGGTGCTGATGTGGAGG + Intronic
948999117 2:241602238-241602260 ATTGGTGGGTGGAGGTGGGAGGG - Intronic
1172014647 20:31865831-31865853 ATTTGCTGATGGAGGGGGGAAGG + Intronic
1172090850 20:32431431-32431453 AGCTGCTGCTGGAAGTGTGATGG - Exonic
1172112107 20:32553106-32553128 ATTTGCTGGTGGAAATGGGGCGG - Intronic
1172532929 20:35646084-35646106 AATTGCTGGGGTAGGGGTGATGG - Intronic
1174391365 20:50220213-50220235 CTTGGGTGGTGGAGGTGAGAAGG + Intergenic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175172551 20:57090739-57090761 GTGTGGTGGTGGAGGTGTGTGGG - Intergenic
1175549488 20:59808046-59808068 TCTTGCTGGTTGAGGTCTGAAGG + Intronic
1176974417 21:15302820-15302842 ATGTGCTGGTGATGGGGTGATGG - Intergenic
1178378339 21:32087187-32087209 ATTTGAGGGAGGAGGTGGGATGG + Intergenic
1179146294 21:38770898-38770920 ATGGGCAGGTGGAGGTGTGCAGG - Intergenic
1179225234 21:39447110-39447132 TTTTGCTGGTGGTGGTGGGCGGG + Intronic
1183056282 22:35308168-35308190 ATTGGCTTATGCAGGTGTGAAGG - Intronic
1183306308 22:37084921-37084943 ATTTGCTGGCAGAGGTGGTAGGG - Intronic
1183556374 22:38530466-38530488 TTTTGCGGGGGGAGGTGAGATGG + Intronic
1184057211 22:42060564-42060586 ATTTGCTGGTGGAGAAGTGATGG - Intronic
1184357007 22:43988752-43988774 ATTTGCAGGTGGAAGTGAGTTGG + Intronic
1184396029 22:44241441-44241463 ATTTGTTGGTGGTGGTGTTCTGG + Intergenic
1184530066 22:45049713-45049735 AATGGCAGGTGGAGGAGTGAGGG - Intergenic
1185180439 22:49357493-49357515 ATTTACTGGAGGAAGTGTGGTGG - Intergenic
949145983 3:700745-700767 CTATACTGGTGGAGGTGGGAAGG + Intergenic
949232970 3:1773179-1773201 ATTTGTTGGGGGAGGAGTTAGGG - Intergenic
950159272 3:10747349-10747371 AGGTGTTGGTGGTGGTGTGAGGG - Intergenic
952216096 3:31279234-31279256 GGTTGCGGGTGGAGGGGTGAGGG - Intergenic
952235802 3:31478909-31478931 ATTTTCTTTTGGAGGTGTCATGG - Intergenic
952307396 3:32158364-32158386 CTTTGGTGGTGGAGGTGGGCTGG + Intronic
954387019 3:50249415-50249437 ATTGGCAGGTGGAGGAGTGTTGG + Intronic
954453235 3:50582963-50582985 ATATGCTGGTGGTGGTGGGGAGG - Exonic
954989612 3:54829432-54829454 TTTGGCTGGTGGAGGAGGGAAGG + Intronic
955973389 3:64458263-64458285 ATTTGCGGGGGGAGGGGTGGGGG - Intergenic
957483046 3:80823148-80823170 TTCTGCTGGAGGAGGTTTGATGG + Intergenic
958364976 3:93040485-93040507 ATTTTCAGGTGGAGGTATCAAGG + Intergenic
958394817 3:93528431-93528453 ATTTTCAGGTGGAGGTATCAAGG + Intergenic
958480737 3:94643140-94643162 CTTTTCTGGTGGAGGTGGCAGGG + Intergenic
958827700 3:99051551-99051573 AATGGGTGGTGGAGGTGGGAAGG + Intergenic
959997329 3:112693730-112693752 TTGTGCTGGTGGAGGTGGCAGGG - Intergenic
960810868 3:121626416-121626438 ACTTGCTGGTGGAGGAGCAAGGG + Intronic
961343989 3:126249297-126249319 CGTTGCTGGTGGAGGTGTGCTGG + Intergenic
961388914 3:126540809-126540831 AGTTGCTGGTGGGAGTGTAAAGG - Intronic
962873130 3:139515486-139515508 CATTGGGGGTGGAGGTGTGATGG + Intergenic
963291801 3:143497877-143497899 ATTGGATGGTGGAGGTGAGGGGG - Intronic
964285029 3:155108763-155108785 GTTTTCTGGTGGAGGGGGGAGGG - Intronic
964722234 3:159779063-159779085 AGTTTCTGGTGGAATTGTGAAGG + Intronic
968802944 4:2755537-2755559 AGGTGCTGGTGGAGGTGAGGGGG - Intronic
969057901 4:4413598-4413620 ACGTGCTGGTGGGGGTGTGCTGG + Intronic
970215805 4:13759023-13759045 ATTTTCTGGTGGTTCTGTGAGGG + Intergenic
970863965 4:20737887-20737909 TTTGGGTGGTGGAGGTGGGAAGG + Intronic
971073751 4:23124978-23125000 CTTTGATGGTGTGGGTGTGAAGG + Intergenic
973606356 4:52591128-52591150 ACCTGCTGCAGGAGGTGTGAAGG + Exonic
974016069 4:56650329-56650351 ATGTGCTGATGGAGATGGGATGG + Intronic
974394069 4:61312712-61312734 ATTTGCTGGTGTTGGTGTTTTGG - Intronic
974765609 4:66341736-66341758 ATTTGCTGGTAGTAGTGGGATGG - Intergenic
979289979 4:118968666-118968688 AGTCCCTGGTGGAGGAGTGATGG + Intronic
980237045 4:130121994-130122016 ATTTTCTGTTGGAGCTGTGATGG - Intergenic
981427377 4:144619019-144619041 ATGTGATGGTGGGGGTGGGATGG - Intergenic
983210341 4:164952048-164952070 ATTTGATCCCGGAGGTGTGAGGG - Intergenic
983296538 4:165874339-165874361 TTTTGCTGGGGGAGGGGAGAGGG - Intronic
983567864 4:169173923-169173945 ATTTGGTAGTGGTGGTGTGTGGG - Intronic
986534729 5:8775372-8775394 CTCTGCAGGTGGAAGTGTGAGGG - Intergenic
986787363 5:11126818-11126840 ACTTGCTGCTGTAAGTGTGAAGG - Intronic
988468791 5:31516380-31516402 CTTTGTTAGTGGAGCTGTGAAGG - Intronic
988828881 5:34968570-34968592 ATGTGCTGGTGGCGGTGGGTAGG + Intergenic
989359921 5:40590144-40590166 ATCTGAGGGTGGAGGTTTGAAGG - Intergenic
990015742 5:51060053-51060075 ATTTTCTGGTGAGGGTGAGAAGG + Intergenic
990148945 5:52794747-52794769 CTTTGCTGGTGGAGGTCACATGG + Intronic
991419059 5:66422301-66422323 ATGTGCAGGTGGAGAAGTGAAGG - Intergenic
992551585 5:77865335-77865357 ATTTGCTGTTGGAAGGGTGGAGG + Intronic
994326934 5:98459088-98459110 GTTTTCTGGTGGTGGTGGGATGG - Intergenic
994509973 5:100690164-100690186 ATATGGTGGTGGAGGTGGGGCGG + Intergenic
995737372 5:115316150-115316172 AATTGCTGGTGGTGGGGTGAGGG - Intergenic
996033612 5:118733861-118733883 TTTTGCTGGTGGAGCTTTCATGG + Intergenic
996182961 5:120442470-120442492 ATTTGCTGGTGGCATTGGGAAGG - Intergenic
996762408 5:126999548-126999570 ATTGGCTGGTGAAGCTGTAATGG - Intronic
996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG + Intergenic
997523556 5:134538487-134538509 ATTTGCTGGTGCAGGGATAAGGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997612764 5:135226678-135226700 ATGTCCTGGTGGAGGTTTTAAGG + Intronic
997797029 5:136820661-136820683 ATTTGGTGGTGGTGGTGGAATGG - Intergenic
998150259 5:139753083-139753105 GTTTGCTGATGGTGGTGGGATGG - Intergenic
999480111 5:151940532-151940554 ATTGGCAGGAGGAGGTGTGGGGG + Intergenic
1000440436 5:161256820-161256842 GTTTACTTGTGGAGCTGTGATGG + Intergenic
1000630746 5:163587803-163587825 GTTTTCTGGTGGTGGTGTGAGGG - Intergenic
1000971504 5:167719852-167719874 ATTTGTTGGGGGTGGTGGGAGGG - Intronic
1001400073 5:171441115-171441137 AGTTGGTGGTGGAGCTGGGAGGG + Intronic
1001441134 5:171743803-171743825 ATCTGCTCGTGGAGATTTGAGGG + Intergenic
1001535636 5:172496014-172496036 ATTCACTGGTGAAGGTGGGAGGG - Intergenic
1001833634 5:174811280-174811302 ATTTGGTGGTGGTGGTCTGGGGG + Intergenic
1001893445 5:175358898-175358920 ATTTGTTGGTAAAGCTGTGAGGG - Intergenic
1002278132 5:178116146-178116168 ATTTGGTGGGGGAGGAGGGAGGG - Intronic
1002348556 5:178565472-178565494 GGTTGCTGGTGGTGGTGAGAAGG - Intronic
1002814691 6:668779-668801 GTATGCTGGTGGATGTGTGTGGG - Intronic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1005777975 6:29158785-29158807 ATTTGCTTGTGGACATGTAATGG + Intergenic
1005912766 6:30325939-30325961 GTATGCTGGGAGAGGTGTGAGGG - Intergenic
1006602280 6:35233928-35233950 GGTTGCTGGTGGAGCTGAGAGGG - Intronic
1006755952 6:36415660-36415682 AGTAGCTGGAGGAGGTGTGTTGG + Intronic
1006989186 6:38198980-38199002 CTTTGAAGGTGGAGGTGTGCAGG + Intronic
1007322960 6:41040480-41040502 CTTCCCTGGTGGAGGTGAGAGGG + Intronic
1007366361 6:41396860-41396882 ATTTTGTGGTGGGGGTGGGAGGG - Intergenic
1007955415 6:45913785-45913807 AGTTGCTGGAGGAAGTGAGAAGG + Intronic
1008307298 6:49918850-49918872 ATGAGCTGGTGGAAGTGTGATGG - Intergenic
1009994593 6:70884303-70884325 ATTTAATGGTGGAGGTGTAAAGG - Intronic
1012419272 6:99044985-99045007 TGTTGCTGGTGGAGCTGAGAGGG - Intergenic
1012546945 6:100430835-100430857 ATCCTCTGGTGGAGGGGTGAAGG + Intronic
1012999149 6:106004610-106004632 TTTTGCTTGTGGAGGTGTAATGG + Intergenic
1013023149 6:106240576-106240598 TATTGCTGGTGGAGATGTAAGGG + Intronic
1014138905 6:117918551-117918573 AGTTGTTGGGGGAGGTGTGTAGG + Intronic
1014398035 6:120950887-120950909 GTTTGGTGGTGTTGGTGTGAAGG - Intergenic
1014522895 6:122466874-122466896 ATTAACTGGTGGAGAAGTGAAGG + Intronic
1014543137 6:122700294-122700316 ATTTGGTGGTGGTGGGGTGGTGG + Intronic
1014911043 6:127093303-127093325 GTTAGGTGGTGGAGGTGGGAAGG - Intergenic
1015403793 6:132814972-132814994 CATTGCTGCTGGAGGTGTAATGG + Exonic
1015927288 6:138323047-138323069 TTTTGCTTGTAGAGGAGTGATGG + Intronic
1017144909 6:151225911-151225933 CATTGCTGCTGGAGGTGTAATGG - Intergenic
1017191868 6:151662578-151662600 ATTTGCTGGTGCAGGGTTGAGGG - Intronic
1018360530 6:163063085-163063107 ATGTGCTGGTGAGGGTGAGAGGG - Intronic
1019429055 7:990376-990398 GTGTGCTGGGGGCGGTGTGATGG + Intergenic
1020783485 7:12544832-12544854 ATTTGATGGTGGTGGTTTAAAGG - Intergenic
1023481409 7:40638756-40638778 ATTGCCTTCTGGAGGTGTGATGG + Intronic
1023555010 7:41412565-41412587 ACTTGGTGGTGGAGGTTTGGAGG - Intergenic
1023839068 7:44085769-44085791 ACCTGCTGGAGGAGGGGTGAGGG + Intergenic
1023869905 7:44257549-44257571 AGAGGCTGGTGGAGGTGTGCTGG + Intronic
1024049729 7:45610862-45610884 AGATGATGGTGGAGGTGGGAAGG + Intronic
1024049763 7:45611001-45611023 AGGTGGTGGTGGAGGTGTGGAGG + Intronic
1024344826 7:48302491-48302513 ATTTGAGGGTGGAGGTTGGAAGG - Intronic
1024395752 7:48864768-48864790 ATTTGGGGGTGGGGGTGGGAAGG + Intergenic
1024399482 7:48907508-48907530 ATTTGGGGGTGGGGGTGGGAAGG - Intergenic
1026130719 7:67618743-67618765 TTTCACAGGTGGAGGTGTGAGGG + Intergenic
1026717875 7:72805733-72805755 AATGGTTGCTGGAGGTGTGAAGG + Intronic
1028965340 7:96795809-96795831 AGGTGCTGGTGGGGGTTTGAGGG + Intergenic
1030197895 7:106870091-106870113 ATATGGTGGTGGATTTGTGAAGG - Intronic
1031140241 7:117934685-117934707 ATTTAGAGGTGGAGGTATGAGGG - Intergenic
1031330060 7:120453162-120453184 CTTTGCTGGTGCATGTGTGTAGG + Intronic
1031420038 7:121540280-121540302 ATTGGGTGGTGGAGGGGTGAAGG + Intergenic
1032786871 7:135208035-135208057 ACTTTCTGGTGGAGGTGGGAAGG - Intronic
1034582685 7:152059342-152059364 TTTTGGAGGTGGAGGTGGGAGGG - Intronic
1036027618 8:4927806-4927828 ATTTGCTGGTGAGTGTGAGAAGG - Intronic
1036075413 8:5493924-5493946 CTTTGCAGCTGGAGGTATGATGG + Intergenic
1036894953 8:12626346-12626368 ATTTGCTGGTGGTAGTGGGCTGG - Intergenic
1037602322 8:20407561-20407583 ATTTGGTGGCGGTGGTGGGAGGG + Intergenic
1040308809 8:46226051-46226073 TTTTGCTTGTGGAGGTCTGTGGG - Intergenic
1040430613 8:47338149-47338171 CTTTCCTGGTGGTGGTGTGTGGG + Intronic
1040923304 8:52648689-52648711 TTTTGCAGTTTGAGGTGTGATGG + Intronic
1041385812 8:57300641-57300663 TATTGCTGGTGAAGGTGGGAGGG + Intergenic
1042733892 8:71966231-71966253 ATTTTCAGGTGGAGGCTTGATGG - Intronic
1043224811 8:77712759-77712781 ATTTGAGGGTGTAAGTGTGATGG - Intergenic
1043437071 8:80245222-80245244 ATTTGGTGTTGCAGGAGTGAAGG - Intergenic
1043463338 8:80482520-80482542 ATGTACTGGTGGGGGTGGGATGG + Intergenic
1045309228 8:100986036-100986058 ATTTGGTGGTGGTGGGGCGATGG - Intergenic
1048550773 8:135432084-135432106 ATTTGGTGCTGCAGGTGTGGGGG + Intergenic
1048750610 8:137669765-137669787 ATTTGCTGGTACAAGTGTGGTGG - Intergenic
1048760418 8:137788380-137788402 ATATGCTGGGGAAGGGGTGAGGG + Intergenic
1049139232 8:140936641-140936663 ATTTGCTGGTGGAGGTGTGAAGG - Intronic
1049301513 8:141872958-141872980 ATGTGCAGGTGAGGGTGTGATGG + Intergenic
1049521269 8:143092638-143092660 GTTTGCAGGAGGAGGGGTGAGGG - Intergenic
1051856297 9:21570529-21570551 ATTTTTTGGTGGAGGTGGGAGGG - Intergenic
1053409565 9:37906817-37906839 ATTTGGTACTGGGGGTGTGAAGG - Intronic
1053411876 9:37921050-37921072 ACAGGCTGGTGGAGGGGTGAGGG - Intronic
1056289571 9:85129074-85129096 AATTGCAGGGGGAGGTGGGAAGG - Intergenic
1056575264 9:87851529-87851551 GTTTCCTGGTGGAGGTGGAAGGG + Intergenic
1057275249 9:93672904-93672926 AGATGCAGGTGCAGGTGTGAGGG + Intronic
1058015316 9:100025166-100025188 ATTTACTGGTGAAGATGTGTGGG - Intronic
1059989614 9:119852979-119853001 ATTTGCTGGGAGAGGGGTGTAGG + Intergenic
1060049559 9:120368038-120368060 AGTTGCTGGGGGTGGTGAGAGGG + Intergenic
1060777734 9:126388670-126388692 AATTGCTGGTGAAGATGTGGAGG - Intronic
1061734129 9:132640793-132640815 ATTTGTTGGGCCAGGTGTGATGG - Intronic
1062679856 9:137773306-137773328 ATTTGGTGGTGGTGGTGTGGAGG + Intronic
1186675238 X:11809376-11809398 AGTTGGTGGTGGAGGAGTCAGGG - Intergenic
1187214922 X:17266891-17266913 ATTGGCTGGAGGAGGAGGGATGG + Intergenic
1187678112 X:21738511-21738533 ATTTGCTAGAGGTGGTGTGTAGG + Intronic
1187998474 X:24955320-24955342 ATTAGCTGGTGGGGGTGGGCGGG - Intronic
1189419247 X:40841902-40841924 AATTGATGGTGGAGGTATGTAGG - Intergenic
1191715315 X:64190198-64190220 ATGGGCAGGTGTAGGTGTGAGGG + Exonic
1193405784 X:81100179-81100201 ACTTGAGGGTGGAGGTTTGAAGG - Intergenic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1194413383 X:93581104-93581126 GGTTGCTTGTGGAGGTGGGAAGG - Intergenic
1194939412 X:99991688-99991710 ATTTGGTGGTGGAGTTGAGGAGG + Intergenic
1196659959 X:118259227-118259249 AGTTCCTGGGGGAGGTGGGAAGG - Intergenic
1197495282 X:127172253-127172275 ATGTGGGGGTGGGGGTGTGATGG + Intergenic
1197659548 X:129155376-129155398 ATTTGGGGGTGGAGGGGTGAGGG + Intergenic
1199420091 X:147635067-147635089 ATTTGATGGTGAACTTGTGAGGG - Intergenic
1199545627 X:149005110-149005132 GTTTGCATGTGGAGGGGTGAGGG - Intergenic
1200958835 Y:8978454-8978476 ATTTCCTGTTGGAGGTCTGGTGG + Intergenic