ID: 1049140303

View in Genome Browser
Species Human (GRCh38)
Location 8:140948702-140948724
Sequence GATCCATGGTTGGTTGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 9, 3: 14, 4: 83}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049140303_1049140306 -9 Left 1049140303 8:140948702-140948724 CCAGATTCAACCAACCATGGATC 0: 1
1: 0
2: 9
3: 14
4: 83
Right 1049140306 8:140948716-140948738 CCATGGATCTAAAATATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049140303 Original CRISPR GATCCATGGTTGGTTGAATC TGG (reversed) Intronic
900600361 1:3500190-3500212 GAGGCTTGGTTGGTGGAATCGGG - Intronic
903162178 1:21497042-21497064 TATCCATGGTTGATTGGACCAGG + Intergenic
903624354 1:24720407-24720429 GCTCCATGGTGGGTGGATTCTGG - Intergenic
907004923 1:50902851-50902873 AATTTGTGGTTGGTTGAATCTGG + Intronic
907654339 1:56327297-56327319 GATCCATGGTTGCCTGAAGATGG + Intergenic
911905659 1:103565426-103565448 CTTCCACAGTTGGTTGAATCTGG + Exonic
914840442 1:151243996-151244018 AGTCCACAGTTGGTTGAATCTGG - Intronic
915500832 1:156316072-156316094 AGTGCATGGTTGGTGGAATCTGG - Intronic
915979524 1:160411180-160411202 AATCCATGGTTGGTTTGAGCAGG + Intronic
920914649 1:210250514-210250536 GATCCCTGATTGTTAGAATCAGG - Intergenic
921388852 1:214599321-214599343 GATCAATGGTTGCTTGTGTCTGG + Intergenic
921818979 1:219594918-219594940 GATGGATGGTTGGTTGAAAGAGG - Intergenic
1066652866 10:37675496-37675518 GATTCATGGTTGGCTGGAACCGG - Intergenic
1068076547 10:52262970-52262992 AATCCTTGGTTGTTTGAATGTGG + Intronic
1069897697 10:71689194-71689216 GAGCCAGGGTTGGTGGAGTCAGG + Intronic
1071043464 10:81342629-81342651 GCTCCAGGGTTGGTTAATTCAGG - Intergenic
1071513304 10:86280965-86280987 TCCCCATGGTTGGTAGAATCAGG - Intronic
1074812798 10:117122502-117122524 GATCCATAGTTAGTTGAAACAGG + Intronic
1074836324 10:117299272-117299294 AATCCACAGTTGATTGAATCTGG + Intronic
1075016257 10:118911974-118911996 GCTCCATGCTTGGGTGACTCAGG - Intergenic
1080647892 11:34200026-34200048 GCTCCATGGGTGGTAGAAACTGG + Intronic
1086772485 11:90784743-90784765 CATCCATGGTTTGGTAAATCAGG + Intergenic
1087746954 11:101958843-101958865 GATTAATTGTTGGATGAATCAGG - Intronic
1096332188 12:50723367-50723389 GATCCTTAGTTGTCTGAATCTGG - Intronic
1100130873 12:91491882-91491904 AATCCACAGTTGTTTGAATCTGG + Intergenic
1100359812 12:93865844-93865866 GATTCACAGTTGGTTGAATCTGG + Intronic
1103191503 12:119005837-119005859 CATCCATTGATGGTTGAATTAGG + Intronic
1104061946 12:125276067-125276089 TATCCATGGGTGTTTGACTCTGG + Intronic
1111627341 13:90806355-90806377 CATGCATGGTTGTTTGAATAGGG - Intergenic
1111979188 13:94999150-94999172 TATCCAAGGTGGGTTGAAACTGG - Intergenic
1112721762 13:102253744-102253766 GATCTGTGGTTAGTTGAATTGGG + Intronic
1112776272 13:102846779-102846801 GATCCGTGGTAGGTTGATTGCGG + Intronic
1112779770 13:102886751-102886773 CACCACTGGTTGGTTGAATCAGG - Intergenic
1113924812 13:113935492-113935514 AAGCCAGGGTTGGTAGAATCAGG - Intergenic
1121692220 14:95886083-95886105 GACCCATGGCTCGGTGAATCAGG - Intergenic
1123792635 15:23737642-23737664 GTACCATGGTTGGTTTAATCAGG + Intergenic
1127255815 15:57291861-57291883 GATCCATGGTTGCTTGAATATGG + Intronic
1127764040 15:62167224-62167246 CATCCGTGGTTGGTTGAATTGGG - Intergenic
1136031087 16:27503690-27503712 GATCCAGTGTTGGGTGAAACAGG - Intronic
1137458704 16:48638323-48638345 GGGCCATGGTTGGAAGAATCAGG - Intergenic
1137661823 16:50213685-50213707 AATCCATTGTTGGTTTAATATGG - Intronic
1138555436 16:57768443-57768465 GATCTGTGGTTGTTTGAATCTGG + Intronic
1140534264 16:75694683-75694705 AATCCATGGTTGTTTGAATCAGG - Intronic
1141007582 16:80366954-80366976 GCTCCAGGGCTGGTTGACTCAGG + Intergenic
1148382988 17:47213557-47213579 AATCCAGAGTTGGTTGAACCTGG + Intronic
1152476021 17:80518725-80518747 GATGGATGGTTGGATGAATGTGG - Intergenic
1155616413 18:27726392-27726414 GATTCACAGTTGGTTGAATTTGG + Intergenic
1163252009 19:16131616-16131638 GATGGATGGTTGGTTGGATGAGG + Intronic
1164510957 19:28896913-28896935 CATCCATGGTGGGTAGAAGCTGG - Intergenic
1167642553 19:50689500-50689522 GATGCATGGATGGATGAATGAGG - Intronic
937029966 2:118730805-118730827 GACCCAGGGTTGGTTTTATCTGG + Intergenic
940801864 2:158141936-158141958 GAATCCTGGTTGGCTGAATCTGG + Intergenic
943041030 2:182805337-182805359 GATCCATTGTTGATTGAATCTGG + Intergenic
943115744 2:183667919-183667941 TATCTGTGGCTGGTTGAATCTGG + Intergenic
947405292 2:229769828-229769850 GCTACATGGTTGGTTGTATGGGG + Intronic
947949124 2:234132618-234132640 GATCCATGGTTGCCTGGATGGGG - Intergenic
1169023781 20:2350064-2350086 GATACATGAATGGTTGAAGCGGG - Intergenic
1173974729 20:47178744-47178766 GATGCATGGATGGATGAATGTGG + Intronic
1174205205 20:48833333-48833355 GTTCCATGGTTGGTTAATTCAGG - Intergenic
1175730608 20:61351173-61351195 GATCTGTGGTTGGTTGATCCAGG - Intronic
1179432007 21:41328075-41328097 GCTCCATGGTTCGTTTAACCAGG - Intronic
1182416861 22:30226883-30226905 GAGCCACGGTTGGTTTAAGCAGG + Intergenic
1183835615 22:40450388-40450410 GATCCATAGTTGGTGAGATCAGG - Intronic
949443724 3:4111269-4111291 AATCCATGATTGGTTGAAAAAGG + Intronic
952730076 3:36629427-36629449 GATACATGTTGGTTTGAATCAGG - Intergenic
954992836 3:54855809-54855831 GATTCATGGTTGGATCAGTCAGG - Intronic
956893570 3:73637323-73637345 GTTCCATGCTTGGGAGAATCAGG + Intergenic
960535930 3:118814231-118814253 GATCCATGGTTTGCAGAACCAGG + Intergenic
961910424 3:130310198-130310220 GATTAATGGTTGGCTGATTCAGG - Intergenic
964337221 3:155668398-155668420 AATCAATGGTTGATTGTATCTGG - Intronic
966276141 3:178172486-178172508 GAGGCATGGTTTGTTGAAGCGGG - Intergenic
967199875 3:187063544-187063566 GATACATGGATGGTAGGATCTGG + Intronic
973560844 4:52133815-52133837 GATTCAGGCTTGGTTGATTCAGG + Intergenic
976627347 4:87200485-87200507 AATCCATGTTTGGTTGAATCTGG + Intronic
980182801 4:129422799-129422821 GAGCCATAGTTGATTGAATGAGG - Intergenic
982510824 4:156281208-156281230 GATCCTTCGTTAGTTGAATTTGG - Intergenic
991452290 5:66765520-66765542 GATCCACAGTTCGTTGAATCTGG + Intronic
997833160 5:137170276-137170298 GATTCATGGTTGGTTGAATTGGG + Intronic
1002401293 5:178992792-178992814 GGTCCAGGGTTGTTTGAAGCAGG + Intronic
1005426932 6:25712717-25712739 GATCCCTGATTGGTTGGTTCAGG + Intergenic
1009566692 6:65319695-65319717 GATGGATGGTTGGTTGAAAGAGG + Intronic
1011272778 6:85596041-85596063 GAACCAGGGTTGGTTGATTGTGG - Intronic
1012660064 6:101877266-101877288 GATCCCTAGTTGATTGAATCTGG - Intronic
1013252952 6:108352899-108352921 GATCCACTGTTGGTTGAATCTGG + Intronic
1014030131 6:116691448-116691470 GATCTGAGGTTGGTTGAATCTGG + Intronic
1015848339 6:137545858-137545880 TATCCAAGGTTGGTTGAATTTGG + Intergenic
1019472380 7:1227844-1227866 AATCCATGGGTGATTAAATCAGG + Intergenic
1022682543 7:32563451-32563473 AATCCAAGGTTGGTTGAATCTGG + Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1033160494 7:138991936-138991958 GATCCTTGGTTGGATGAATTGGG + Intergenic
1035103501 7:156420946-156420968 GATCTATTGCTGGGTGAATCTGG - Intergenic
1037923602 8:22827405-22827427 GATTCATGGTTGCTTGGAACTGG - Intronic
1041229699 8:55736721-55736743 GATCCTTCCTTGGATGAATCAGG + Intronic
1041800118 8:61789580-61789602 GATCCATGTTTGCTTGAGCCCGG - Intergenic
1045784688 8:105907010-105907032 TATCCATGTTTTGTTGAATAGGG - Intergenic
1049140303 8:140948702-140948724 GATCCATGGTTGGTTGAATCTGG - Intronic
1057621791 9:96642896-96642918 AATCCGTGGTTTGTTGAATGAGG - Intronic
1058765130 9:108175059-108175081 GATTTATGATTGGTTGATTCTGG - Intergenic
1060044595 9:120329611-120329633 GATCCATAGTTGTTTGAATCCGG - Intergenic
1203654445 Un_KI270752v1:9511-9533 GATCTACAGTTGGTTGAATCTGG - Intergenic
1186039817 X:5463481-5463503 GATCCATGTTTGGTTAAACCTGG + Intergenic
1186493849 X:9996391-9996413 AATCCCTGGTTGATTGAATCTGG - Intergenic
1186713218 X:12222665-12222687 GATCAATGGTTGGTTGGATCTGG - Intronic
1194169794 X:90566767-90566789 GCTCCATGGGTGTTTGAATGTGG + Intergenic
1195768367 X:108320548-108320570 GATCAATGGATGATTGACTCTGG + Intronic
1198847410 X:140927081-140927103 AAACCATGGTGGGTTGAATAGGG - Intergenic
1200516034 Y:4144540-4144562 GCTCCATGGGTGTTTGAATGTGG + Intergenic