ID: 1049146819

View in Genome Browser
Species Human (GRCh38)
Location 8:141006522-141006544
Sequence GGGATACTGCTCCCTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049146814_1049146819 -5 Left 1049146814 8:141006504-141006526 CCGTGGGGATCTGTCCCAGGGAT No data
Right 1049146819 8:141006522-141006544 GGGATACTGCTCCCTGGCCTGGG No data
1049146811_1049146819 0 Left 1049146811 8:141006499-141006521 CCTCACCGTGGGGATCTGTCCCA No data
Right 1049146819 8:141006522-141006544 GGGATACTGCTCCCTGGCCTGGG No data
1049146807_1049146819 12 Left 1049146807 8:141006487-141006509 CCTAGAGCAGGACCTCACCGTGG No data
Right 1049146819 8:141006522-141006544 GGGATACTGCTCCCTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049146819 Original CRISPR GGGATACTGCTCCCTGGCCT GGG Intergenic