ID: 1049154626

View in Genome Browser
Species Human (GRCh38)
Location 8:141059222-141059244
Sequence GTTTTGGGAGGAAGCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049154613_1049154626 18 Left 1049154613 8:141059181-141059203 CCCAGGAAGTCGGGGCTCCCCCA No data
Right 1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG No data
1049154612_1049154626 25 Left 1049154612 8:141059174-141059196 CCATTAGCCCAGGAAGTCGGGGC No data
Right 1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG No data
1049154620_1049154626 -2 Left 1049154620 8:141059201-141059223 CCAGCTGGTTGCTCCTTGGCTGT No data
Right 1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG No data
1049154619_1049154626 -1 Left 1049154619 8:141059200-141059222 CCCAGCTGGTTGCTCCTTGGCTG No data
Right 1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG No data
1049154617_1049154626 1 Left 1049154617 8:141059198-141059220 CCCCCAGCTGGTTGCTCCTTGGC No data
Right 1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG No data
1049154618_1049154626 0 Left 1049154618 8:141059199-141059221 CCCCAGCTGGTTGCTCCTTGGCT No data
Right 1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG No data
1049154614_1049154626 17 Left 1049154614 8:141059182-141059204 CCAGGAAGTCGGGGCTCCCCCAG No data
Right 1049154626 8:141059222-141059244 GTTTTGGGAGGAAGCGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049154626 Original CRISPR GTTTTGGGAGGAAGCGGCCC TGG Intergenic
No off target data available for this crispr