ID: 1049156597

View in Genome Browser
Species Human (GRCh38)
Location 8:141070968-141070990
Sequence TCCTGGCCTCCGCGTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049156597_1049156600 -9 Left 1049156597 8:141070968-141070990 CCTCCCTGACGCGGAGGCCAGGA No data
Right 1049156600 8:141070982-141071004 AGGCCAGGAGTCCAAAATCAAGG No data
1049156597_1049156605 23 Left 1049156597 8:141070968-141070990 CCTCCCTGACGCGGAGGCCAGGA No data
Right 1049156605 8:141071014-141071036 TTCTGTGAGGACCCGCTTCTTGG No data
1049156597_1049156603 10 Left 1049156597 8:141070968-141070990 CCTCCCTGACGCGGAGGCCAGGA No data
Right 1049156603 8:141071001-141071023 AAGGTGCCGCTGATTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049156597 Original CRISPR TCCTGGCCTCCGCGTCAGGG AGG (reversed) Intergenic
No off target data available for this crispr