ID: 1049156701

View in Genome Browser
Species Human (GRCh38)
Location 8:141071626-141071648
Sequence CCCAGGGCCTTGCACACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049156701_1049156706 28 Left 1049156701 8:141071626-141071648 CCTGCTGTGTGCAAGGCCCTGGG No data
Right 1049156706 8:141071677-141071699 TGCCTCCTGCCAGACCGTGCTGG No data
1049156701_1049156707 29 Left 1049156701 8:141071626-141071648 CCTGCTGTGTGCAAGGCCCTGGG No data
Right 1049156707 8:141071678-141071700 GCCTCCTGCCAGACCGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049156701 Original CRISPR CCCAGGGCCTTGCACACAGC AGG (reversed) Intergenic
No off target data available for this crispr