ID: 1049156704

View in Genome Browser
Species Human (GRCh38)
Location 8:141071642-141071664
Sequence ACTCAACACAGAGCCACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049156704_1049156706 12 Left 1049156704 8:141071642-141071664 CCCTGGGTGGCTCTGTGTTGAGT No data
Right 1049156706 8:141071677-141071699 TGCCTCCTGCCAGACCGTGCTGG No data
1049156704_1049156712 30 Left 1049156704 8:141071642-141071664 CCCTGGGTGGCTCTGTGTTGAGT No data
Right 1049156712 8:141071695-141071717 GCTGGGCTCTTCTACACACCTGG No data
1049156704_1049156707 13 Left 1049156704 8:141071642-141071664 CCCTGGGTGGCTCTGTGTTGAGT No data
Right 1049156707 8:141071678-141071700 GCCTCCTGCCAGACCGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049156704 Original CRISPR ACTCAACACAGAGCCACCCA GGG (reversed) Intergenic
No off target data available for this crispr