ID: 1049156706

View in Genome Browser
Species Human (GRCh38)
Location 8:141071677-141071699
Sequence TGCCTCCTGCCAGACCGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049156705_1049156706 11 Left 1049156705 8:141071643-141071665 CCTGGGTGGCTCTGTGTTGAGTA No data
Right 1049156706 8:141071677-141071699 TGCCTCCTGCCAGACCGTGCTGG No data
1049156704_1049156706 12 Left 1049156704 8:141071642-141071664 CCCTGGGTGGCTCTGTGTTGAGT No data
Right 1049156706 8:141071677-141071699 TGCCTCCTGCCAGACCGTGCTGG No data
1049156701_1049156706 28 Left 1049156701 8:141071626-141071648 CCTGCTGTGTGCAAGGCCCTGGG No data
Right 1049156706 8:141071677-141071699 TGCCTCCTGCCAGACCGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049156706 Original CRISPR TGCCTCCTGCCAGACCGTGC TGG Intergenic
No off target data available for this crispr