ID: 1049156858

View in Genome Browser
Species Human (GRCh38)
Location 8:141072718-141072740
Sequence AGCCCCGGCGAGCAAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049156853_1049156858 11 Left 1049156853 8:141072684-141072706 CCTGCTGGGATCATGACAGACAC No data
Right 1049156858 8:141072718-141072740 AGCCCCGGCGAGCAAGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049156858 Original CRISPR AGCCCCGGCGAGCAAGGCCT GGG Intergenic
No off target data available for this crispr