ID: 1049161707

View in Genome Browser
Species Human (GRCh38)
Location 8:141102362-141102384
Sequence GGGACAGTGCCCCGGGCGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161694_1049161707 20 Left 1049161694 8:141102319-141102341 CCAAGCCTGGTTTGGGGAGCTGG No data
Right 1049161707 8:141102362-141102384 GGGACAGTGCCCCGGGCGCTGGG No data
1049161696_1049161707 15 Left 1049161696 8:141102324-141102346 CCTGGTTTGGGGAGCTGGACATC No data
Right 1049161707 8:141102362-141102384 GGGACAGTGCCCCGGGCGCTGGG No data
1049161693_1049161707 21 Left 1049161693 8:141102318-141102340 CCCAAGCCTGGTTTGGGGAGCTG No data
Right 1049161707 8:141102362-141102384 GGGACAGTGCCCCGGGCGCTGGG No data
1049161703_1049161707 -7 Left 1049161703 8:141102346-141102368 CCAGGGGCAGCGCGTGGGGACAG No data
Right 1049161707 8:141102362-141102384 GGGACAGTGCCCCGGGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161707 Original CRISPR GGGACAGTGCCCCGGGCGCT GGG Intergenic