ID: 1049161846

View in Genome Browser
Species Human (GRCh38)
Location 8:141103004-141103026
Sequence GTGGCACCGGGCAGAAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161846_1049161860 18 Left 1049161846 8:141103004-141103026 CCCAGGCTTCTGCCCGGTGCCAC No data
Right 1049161860 8:141103045-141103067 TTCCTGAAAAGGCACCAGGCTGG No data
1049161846_1049161853 7 Left 1049161846 8:141103004-141103026 CCCAGGCTTCTGCCCGGTGCCAC No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
1049161846_1049161857 14 Left 1049161846 8:141103004-141103026 CCCAGGCTTCTGCCCGGTGCCAC No data
Right 1049161857 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161846 Original CRISPR GTGGCACCGGGCAGAAGCCT GGG (reversed) Intergenic