ID: 1049161847

View in Genome Browser
Species Human (GRCh38)
Location 8:141103005-141103027
Sequence AGTGGCACCGGGCAGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161847_1049161853 6 Left 1049161847 8:141103005-141103027 CCAGGCTTCTGCCCGGTGCCACT No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
1049161847_1049161857 13 Left 1049161847 8:141103005-141103027 CCAGGCTTCTGCCCGGTGCCACT No data
Right 1049161857 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data
1049161847_1049161862 30 Left 1049161847 8:141103005-141103027 CCAGGCTTCTGCCCGGTGCCACT No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161847_1049161860 17 Left 1049161847 8:141103005-141103027 CCAGGCTTCTGCCCGGTGCCACT No data
Right 1049161860 8:141103045-141103067 TTCCTGAAAAGGCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161847 Original CRISPR AGTGGCACCGGGCAGAAGCC TGG (reversed) Intergenic