ID: 1049161848

View in Genome Browser
Species Human (GRCh38)
Location 8:141103016-141103038
Sequence TGGGGAGGAGCAGTGGCACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161848_1049161864 20 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161864 8:141103059-141103081 CCAGGCTGGCAGAACTCACCGGG No data
1049161848_1049161862 19 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161848_1049161860 6 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161860 8:141103045-141103067 TTCCTGAAAAGGCACCAGGCTGG No data
1049161848_1049161853 -5 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
1049161848_1049161865 24 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161865 8:141103063-141103085 GCTGGCAGAACTCACCGGGCAGG No data
1049161848_1049161866 25 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161848_1049161857 2 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161857 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161848 Original CRISPR TGGGGAGGAGCAGTGGCACC GGG (reversed) Intergenic