ID: 1049161849

View in Genome Browser
Species Human (GRCh38)
Location 8:141103017-141103039
Sequence ATGGGGAGGAGCAGTGGCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161849_1049161864 19 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161864 8:141103059-141103081 CCAGGCTGGCAGAACTCACCGGG No data
1049161849_1049161865 23 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161865 8:141103063-141103085 GCTGGCAGAACTCACCGGGCAGG No data
1049161849_1049161866 24 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161849_1049161862 18 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161849_1049161853 -6 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
1049161849_1049161860 5 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161860 8:141103045-141103067 TTCCTGAAAAGGCACCAGGCTGG No data
1049161849_1049161857 1 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161857 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161849 Original CRISPR ATGGGGAGGAGCAGTGGCAC CGG (reversed) Intergenic