ID: 1049161850

View in Genome Browser
Species Human (GRCh38)
Location 8:141103023-141103045
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161850_1049161866 18 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161850_1049161857 -5 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161857 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data
1049161850_1049161860 -1 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161860 8:141103045-141103067 TTCCTGAAAAGGCACCAGGCTGG No data
1049161850_1049161865 17 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161865 8:141103063-141103085 GCTGGCAGAACTCACCGGGCAGG No data
1049161850_1049161864 13 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161864 8:141103059-141103081 CCAGGCTGGCAGAACTCACCGGG No data
1049161850_1049161862 12 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161850 Original CRISPR AGGGGCATGGGGAGGAGCAG TGG (reversed) Intergenic