ID: 1049161851

View in Genome Browser
Species Human (GRCh38)
Location 8:141103031-141103053
Sequence TTTCAGGAAGGGGCATGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161851_1049161866 10 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161851_1049161864 5 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161864 8:141103059-141103081 CCAGGCTGGCAGAACTCACCGGG No data
1049161851_1049161868 30 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161868 8:141103084-141103106 GGGTTCCTCCACCACCTTGCTGG No data
1049161851_1049161860 -9 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161860 8:141103045-141103067 TTCCTGAAAAGGCACCAGGCTGG No data
1049161851_1049161865 9 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161865 8:141103063-141103085 GCTGGCAGAACTCACCGGGCAGG No data
1049161851_1049161862 4 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161851 Original CRISPR TTTCAGGAAGGGGCATGGGG AGG (reversed) Intergenic