ID: 1049161853

View in Genome Browser
Species Human (GRCh38)
Location 8:141103034-141103056
Sequence CCCCATGCCCCTTCCTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161848_1049161853 -5 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
1049161847_1049161853 6 Left 1049161847 8:141103005-141103027 CCAGGCTTCTGCCCGGTGCCACT No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
1049161846_1049161853 7 Left 1049161846 8:141103004-141103026 CCCAGGCTTCTGCCCGGTGCCAC No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
1049161849_1049161853 -6 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161853 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161853 Original CRISPR CCCCATGCCCCTTCCTGAAA AGG Intergenic