ID: 1049161855

View in Genome Browser
Species Human (GRCh38)
Location 8:141103036-141103058
Sequence TGCCTTTTCAGGAAGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161855_1049161866 5 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161855_1049161862 -1 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 206
1049161855_1049161868 25 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161868 8:141103084-141103106 GGGTTCCTCCACCACCTTGCTGG No data
1049161855_1049161869 26 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161855_1049161865 4 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161865 8:141103063-141103085 GCTGGCAGAACTCACCGGGCAGG No data
1049161855_1049161864 0 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161864 8:141103059-141103081 CCAGGCTGGCAGAACTCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161855 Original CRISPR TGCCTTTTCAGGAAGGGGCA TGG (reversed) Intergenic