ID: 1049161858

View in Genome Browser
Species Human (GRCh38)
Location 8:141103042-141103064
Sequence GCCTGGTGCCTTTTCAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161858_1049161862 -7 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 206
1049161858_1049161873 30 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161873 8:141103095-141103117 CCACCTTGCTGGGCACAGCTTGG No data
1049161858_1049161865 -2 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161865 8:141103063-141103085 GCTGGCAGAACTCACCGGGCAGG No data
1049161858_1049161866 -1 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161858_1049161868 19 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161868 8:141103084-141103106 GGGTTCCTCCACCACCTTGCTGG No data
1049161858_1049161869 20 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161858_1049161864 -6 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161864 8:141103059-141103081 CCAGGCTGGCAGAACTCACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161858 Original CRISPR GCCTGGTGCCTTTTCAGGAA GGG (reversed) Intergenic