ID: 1049161861

View in Genome Browser
Species Human (GRCh38)
Location 8:141103047-141103069
Sequence TGCCAGCCTGGTGCCTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161861_1049161873 25 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161873 8:141103095-141103117 CCACCTTGCTGGGCACAGCTTGG No data
1049161861_1049161875 28 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161875 8:141103098-141103120 CCTTGCTGGGCACAGCTTGGAGG No data
1049161861_1049161869 15 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161861_1049161866 -6 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161861_1049161868 14 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161868 8:141103084-141103106 GGGTTCCTCCACCACCTTGCTGG No data
1049161861_1049161865 -7 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161865 8:141103063-141103085 GCTGGCAGAACTCACCGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161861 Original CRISPR TGCCAGCCTGGTGCCTTTTC AGG (reversed) Intergenic