ID: 1049161862

View in Genome Browser
Species Human (GRCh38)
Location 8:141103058-141103080
Sequence ACCAGGCTGGCAGAACTCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161849_1049161862 18 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161851_1049161862 4 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161852_1049161862 1 Left 1049161852 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161850_1049161862 12 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161855_1049161862 -1 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161858_1049161862 -7 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161856_1049161862 -6 Left 1049161856 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161848_1049161862 19 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161859_1049161862 -8 Left 1049161859 8:141103043-141103065 CCTTCCTGAAAAGGCACCAGGCT No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161854_1049161862 0 Left 1049161854 8:141103035-141103057 CCCATGCCCCTTCCTGAAAAGGC No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data
1049161847_1049161862 30 Left 1049161847 8:141103005-141103027 CCAGGCTTCTGCCCGGTGCCACT No data
Right 1049161862 8:141103058-141103080 ACCAGGCTGGCAGAACTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161862 Original CRISPR ACCAGGCTGGCAGAACTCAC CGG Intergenic