ID: 1049161866

View in Genome Browser
Species Human (GRCh38)
Location 8:141103064-141103086
Sequence CTGGCAGAACTCACCGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161856_1049161866 0 Left 1049161856 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161850_1049161866 18 Left 1049161850 8:141103023-141103045 CCACTGCTCCTCCCCATGCCCCT No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161855_1049161866 5 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161851_1049161866 10 Left 1049161851 8:141103031-141103053 CCTCCCCATGCCCCTTCCTGAAA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161852_1049161866 7 Left 1049161852 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161849_1049161866 24 Left 1049161849 8:141103017-141103039 CCGGTGCCACTGCTCCTCCCCAT No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161848_1049161866 25 Left 1049161848 8:141103016-141103038 CCCGGTGCCACTGCTCCTCCCCA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161861_1049161866 -6 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161854_1049161866 6 Left 1049161854 8:141103035-141103057 CCCATGCCCCTTCCTGAAAAGGC No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161858_1049161866 -1 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data
1049161859_1049161866 -2 Left 1049161859 8:141103043-141103065 CCTTCCTGAAAAGGCACCAGGCT No data
Right 1049161866 8:141103064-141103086 CTGGCAGAACTCACCGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161866 Original CRISPR CTGGCAGAACTCACCGGGCA GGG Intergenic