ID: 1049161869

View in Genome Browser
Species Human (GRCh38)
Location 8:141103085-141103107
Sequence GGTTCCTCCACCACCTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049161852_1049161869 28 Left 1049161852 8:141103034-141103056 CCCCATGCCCCTTCCTGAAAAGG No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161861_1049161869 15 Left 1049161861 8:141103047-141103069 CCTGAAAAGGCACCAGGCTGGCA No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161855_1049161869 26 Left 1049161855 8:141103036-141103058 CCATGCCCCTTCCTGAAAAGGCA No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161863_1049161869 3 Left 1049161863 8:141103059-141103081 CCAGGCTGGCAGAACTCACCGGG No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161859_1049161869 19 Left 1049161859 8:141103043-141103065 CCTTCCTGAAAAGGCACCAGGCT No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161854_1049161869 27 Left 1049161854 8:141103035-141103057 CCCATGCCCCTTCCTGAAAAGGC No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161858_1049161869 20 Left 1049161858 8:141103042-141103064 CCCTTCCTGAAAAGGCACCAGGC No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data
1049161856_1049161869 21 Left 1049161856 8:141103041-141103063 CCCCTTCCTGAAAAGGCACCAGG No data
Right 1049161869 8:141103085-141103107 GGTTCCTCCACCACCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049161869 Original CRISPR GGTTCCTCCACCACCTTGCT GGG Intergenic