ID: 1049167663

View in Genome Browser
Species Human (GRCh38)
Location 8:141136727-141136749
Sequence GCCTGAGGATGTCGCCGTCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049167660_1049167663 -9 Left 1049167660 8:141136713-141136735 CCCAGAGCGCCAGAGCCTGAGGA 0: 1
1: 0
2: 3
3: 23
4: 226
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167653_1049167663 4 Left 1049167653 8:141136700-141136722 CCTCCCGGGGCCCCCCAGAGCGC 0: 1
1: 0
2: 2
3: 53
4: 1010
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167648_1049167663 26 Left 1049167648 8:141136678-141136700 CCAGACCAGAGCAGTGGAAGGGC 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167646_1049167663 27 Left 1049167646 8:141136677-141136699 CCCAGACCAGAGCAGTGGAAGGG 0: 1
1: 0
2: 2
3: 27
4: 246
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167658_1049167663 -8 Left 1049167658 8:141136712-141136734 CCCCAGAGCGCCAGAGCCTGAGG 0: 1
1: 0
2: 1
3: 25
4: 263
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167661_1049167663 -10 Left 1049167661 8:141136714-141136736 CCAGAGCGCCAGAGCCTGAGGAT 0: 1
1: 1
2: 2
3: 24
4: 178
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167654_1049167663 1 Left 1049167654 8:141136703-141136725 CCCGGGGCCCCCCAGAGCGCCAG 0: 1
1: 0
2: 4
3: 25
4: 315
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167657_1049167663 -7 Left 1049167657 8:141136711-141136733 CCCCCAGAGCGCCAGAGCCTGAG 0: 1
1: 0
2: 1
3: 20
4: 248
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167656_1049167663 -6 Left 1049167656 8:141136710-141136732 CCCCCCAGAGCGCCAGAGCCTGA 0: 1
1: 0
2: 0
3: 13
4: 330
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167655_1049167663 0 Left 1049167655 8:141136704-141136726 CCGGGGCCCCCCAGAGCGCCAGA 0: 1
1: 0
2: 0
3: 33
4: 610
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62
1049167649_1049167663 21 Left 1049167649 8:141136683-141136705 CCAGAGCAGTGGAAGGGCCTCCC 0: 1
1: 1
2: 2
3: 15
4: 160
Right 1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049167663 Original CRISPR GCCTGAGGATGTCGCCGTCC CGG Exonic
907720613 1:56968473-56968495 GCCTGAGGCTGCCGTCCTCCAGG - Intergenic
912685092 1:111755981-111756003 GGCTGAGCATGTGGCCGTGCAGG + Exonic
913547718 1:119886051-119886073 GCCTGTAGATGTCTCTGTCCTGG + Intergenic
913556072 1:119968467-119968489 GCCTGTAGATGTCTCTGTCCTGG - Intronic
919314009 1:195948408-195948430 GCCTGAGGATGAGGCCCTACTGG + Intergenic
922322988 1:224503911-224503933 GCCTGAGGGCGTCTCTGTCCCGG - Intronic
1071545017 10:86522167-86522189 GCCTGCGGAGGCCGCCGCCCGGG + Intergenic
1072207981 10:93221377-93221399 GCCTGAGGCTGTGGCTGTCGAGG - Intergenic
1072881434 10:99233139-99233161 CCCTGGGGATCTCTCCGTCCGGG - Intronic
1077524787 11:3057500-3057522 GGCTCCGGATGTCGCCGGCCCGG + Intronic
1080790352 11:35517106-35517128 GCCTGATGATGTGGCAGTCTGGG - Intronic
1083793585 11:65001744-65001766 GCCTGAGAATGTAGCCAGCCTGG - Intergenic
1083794630 11:65008052-65008074 GCCTGAGAATGTAGCCAGCCCGG + Intergenic
1087056654 11:93943448-93943470 ACCTGAGGATGTCTCCATACAGG + Intergenic
1088243244 11:107792284-107792306 GCCTGAGGCTGGCTCAGTCCTGG + Exonic
1089184574 11:116606182-116606204 GCCTGGGGATCTTGCAGTCCAGG - Intergenic
1093954283 12:25198187-25198209 GCCTGAGGATGCCCCAGTCCAGG - Intronic
1105206817 13:18232588-18232610 CGCTGATGGTGTCGCCGTCCAGG + Intergenic
1105207269 13:18234724-18234746 CGCTGATGGTGTCGCCGTCCAGG + Intergenic
1128877749 15:71215726-71215748 GGCTGAGGATCTCTCCTTCCCGG - Intronic
1131609210 15:93943535-93943557 GGCTGAGGATGTCGCCAAGCAGG - Intergenic
1132094134 15:98969555-98969577 AGCTGCGGATGTCGGCGTCCCGG + Exonic
1141706367 16:85667383-85667405 TCCTGAGGATGTCACCCACCAGG + Intronic
1143129205 17:4665486-4665508 GCATGAGGATGTGGCTGGCCAGG - Intergenic
1147044405 17:37742756-37742778 GCCTGCGGGTGTCGGCGACCCGG + Intronic
1149160442 17:53686971-53686993 GCCTGAGGATGGGGCCTTACTGG + Intergenic
1152354733 17:79801215-79801237 GCTTGAGGATGAGGCCGGCCCGG + Intronic
1153098746 18:1439952-1439974 GCCTGAGGCTGTGGCTGTCCGGG + Intergenic
1157227705 18:45882286-45882308 GCCTGAGAATGTCACTGTACTGG + Exonic
1160548638 18:79679310-79679332 ACGTGAGGCTGTCGGCGTCCTGG - Intergenic
1160697387 19:491677-491699 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697444 19:491810-491832 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1160697527 19:492009-492031 GCCTGGGGCTGTCTCCGCCCAGG - Intronic
1161346366 19:3770604-3770626 GCCTGAGCCTGCCGCCCTCCCGG - Exonic
1164874093 19:31671057-31671079 GCCTGAGGACCGTGCCGTCCTGG - Intergenic
1165006214 19:32809422-32809444 GCCTGTGGGTGTCGCCAGCCCGG + Intronic
1166995147 19:46716517-46716539 ACCTGAGGATGGCGGGGTCCTGG + Exonic
1167344710 19:48937951-48937973 TCCTCAGGGTGTCACCGTCCCGG + Intronic
1168116291 19:54222819-54222841 GCCTGAGCAGGTCCCCGCCCGGG + Intronic
1168217824 19:54939453-54939475 GGCGGAGGATGTCTCCGTCCAGG + Exonic
1168224292 19:54983147-54983169 GGCGGAGGATGTCTCCGTCCAGG - Exonic
1168550676 19:57290751-57290773 GCCTGAGGAAGTCTCACTCCAGG + Exonic
926086251 2:10022219-10022241 CCCTGAGGATGCCTCAGTCCTGG + Intergenic
933403302 2:81826377-81826399 GCCTGAGGGTGTTGCCATCATGG + Intergenic
938083801 2:128385145-128385167 GCCTGAGCATGACTCCTTCCTGG - Intergenic
1173992934 20:47317044-47317066 GGCTGAGGATGAGGCCCTCCTGG - Intronic
1180976548 22:19851829-19851851 GCCTGAGGATCTCGCAGACACGG + Exonic
1181635853 22:24174426-24174448 GCCTGAGGATGGTGACGTCAAGG + Intronic
1184443796 22:44535496-44535518 GCCTGAGGAGCTCTCCCTCCAGG - Intergenic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
951016949 3:17742275-17742297 GCCTGAGGGTGCCGCCGCCACGG - Intronic
953404827 3:42654967-42654989 GCCCGAGGGCGGCGCCGTCCGGG - Intronic
961389358 3:126543048-126543070 GCCTCACGATGGGGCCGTCCCGG + Exonic
976814207 4:89128020-89128042 GCCTGAGGATTTCACCTTCATGG - Intergenic
985959351 5:3287921-3287943 ACCTGATGATGTCTCCATCCTGG + Intergenic
991101069 5:62793849-62793871 GCCTGAGGATCTCTGGGTCCAGG - Intergenic
1005790585 6:29295928-29295950 GCCTGAGGATGGGGCCTTACAGG - Intergenic
1005893420 6:30158506-30158528 GCCTCAAGATGTCCCCATCCTGG + Exonic
1006927267 6:37664002-37664024 GCATGAGGGTGTCCCCCTCCCGG + Exonic
1033275207 7:139966816-139966838 GCCTGAGGATGCCGCCCTGCGGG + Intronic
1034348021 7:150398769-150398791 GCCTGAGGAGGTAGCTGTGCAGG + Intronic
1049167663 8:141136727-141136749 GCCTGAGGATGTCGCCGTCCCGG + Exonic
1049654863 8:143792975-143792997 GCCTGAGGATGCCCCTGCCCAGG - Exonic
1056925407 9:90830243-90830265 GCCTCAGGATGGCGCCGTGGAGG + Intronic
1059566302 9:115385842-115385864 GCCTGAGGGTGGCGCCTTACTGG - Intronic
1060187965 9:121575370-121575392 GCCTGAGGCAGTGGCTGTCCAGG - Intronic
1062529830 9:136994971-136994993 GCGTGAGCCTGTCGCCGTCCAGG + Exonic
1191192135 X:57678803-57678825 GGCGGAGGATGTCTCTGTCCAGG + Intergenic
1191952034 X:66602857-66602879 GCCTGAGGAAGTCCAGGTCCAGG - Intronic