ID: 1049180193

View in Genome Browser
Species Human (GRCh38)
Location 8:141218242-141218264
Sequence ACGACATGCAGAAGCGGCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049180193_1049180197 19 Left 1049180193 8:141218242-141218264 CCGCTGCCGCTTCTGCATGTCGT 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1049180197 8:141218284-141218306 CGACGGCTTGATCAGCACCACGG 0: 1
1: 0
2: 0
3: 2
4: 36
1049180193_1049180198 25 Left 1049180193 8:141218242-141218264 CCGCTGCCGCTTCTGCATGTCGT 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 38
1049180193_1049180196 2 Left 1049180193 8:141218242-141218264 CCGCTGCCGCTTCTGCATGTCGT 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1049180196 8:141218267-141218289 AGGTCGCTCATGCTGCGCGACGG 0: 1
1: 0
2: 0
3: 3
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049180193 Original CRISPR ACGACATGCAGAAGCGGCAG CGG (reversed) Exonic
901727807 1:11255998-11256020 AGGAGATGCAGAAGCCTCAGTGG - Exonic
907669476 1:56462177-56462199 ATGAAATGCAGAAGTGGCTGGGG - Intergenic
914707514 1:150182601-150182623 ACGACACACAGAAGAGGCAAGGG + Intergenic
916686654 1:167153369-167153391 ACCAAATGCACAAGAGGCAGAGG - Intergenic
920821180 1:209382889-209382911 GCCACATGCAGAAGTGTCAGAGG + Intergenic
1063185575 10:3647815-3647837 AGGACTTGCAGCAGGGGCAGGGG - Intergenic
1067102517 10:43343165-43343187 CCGACCTGCAGAACCGCCAGGGG + Intergenic
1072609111 10:97004856-97004878 ACCCCATGCAGCAGCGGCACAGG + Intronic
1075709144 10:124521417-124521439 ACGACATGCCTCAGCTGCAGAGG - Intronic
1076055407 10:127368375-127368397 AGGACAGGAAGAAGCAGCAGGGG - Intronic
1088788103 11:113200813-113200835 ACCACATTCAGGAGAGGCAGGGG + Intronic
1091341972 11:134823137-134823159 AGGACATGCAAATGAGGCAGAGG + Intergenic
1096686555 12:53291982-53292004 AGGACTTGCAGAAGCTGCCGTGG + Exonic
1116733500 14:48657374-48657396 AAGACAGGCAGAGGCTGCAGGGG + Intergenic
1119137864 14:72237513-72237535 ACTACCTGCTGAAGAGGCAGAGG + Intronic
1121012019 14:90525439-90525461 GGGACACGCAGCAGCGGCAGTGG - Exonic
1122405111 14:101496273-101496295 ACAGCATGCAGAGGCTGCAGGGG + Intergenic
1122476334 14:102012334-102012356 GCGAGCTGCAGAAGCGCCAGTGG + Exonic
1125598533 15:40902860-40902882 ACCACATCCAGGAGCTGCAGCGG + Exonic
1125768695 15:42151310-42151332 ACGTCCTGGAGAAGCGGCGGAGG + Intronic
1127565012 15:60178886-60178908 ACCACAGGCACAAGCGCCAGTGG + Intergenic
1130782101 15:87051114-87051136 ACGACCTGCTGAAGGGGAAGAGG + Intergenic
1132345672 15:101107290-101107312 ACCAGATGCCGAAGCGGCAAGGG - Intergenic
1136509637 16:30728976-30728998 AGGAAAAGCGGAAGCGGCAGCGG + Exonic
1142973027 17:3625627-3625649 CCACCATGCAGAAGCAGCAGTGG + Intronic
1143388639 17:6547061-6547083 ACGACAGGCAGCAGAGGCTGTGG - Intronic
1143854631 17:9839555-9839577 AGGCCATGGAGAAGCAGCAGAGG - Intronic
1145311252 17:21702265-21702287 AGGACATGCAGAACCTGCACAGG - Intronic
1147643080 17:42017137-42017159 ACGCCAGGCGGAAGCGGGAGAGG + Exonic
1152196228 17:78919964-78919986 AAGACAGGCAGACGTGGCAGTGG - Intronic
1152587858 17:81197072-81197094 GCGTCAGGCGGAAGCGGCAGAGG + Intronic
1152939060 17:83156401-83156423 ACAACATGCAAGACCGGCAGAGG - Intergenic
1161347851 19:3777042-3777064 GAGACATGCAGAAGTGGGAGAGG + Intergenic
1161751716 19:6102576-6102598 AGGAGAGGCAGAAGAGGCAGGGG - Intronic
1162390812 19:10388979-10389001 ACGACAGGTAGGAGCTGCAGGGG - Intergenic
1164727417 19:30475685-30475707 AGGACATGGAGAAGGGGCTGGGG - Intronic
927339152 2:21961781-21961803 AAGAAATGCAGAAGAGGAAGAGG + Intergenic
936062153 2:109301944-109301966 AAGACATGCAGGAGAGGCTGCGG - Intronic
937011568 2:118567423-118567445 AAGACAGGGAGAAGAGGCAGAGG - Intergenic
938044898 2:128109785-128109807 ACCAAATGCAGAAGCAGCACTGG - Intronic
946321786 2:218958978-218959000 ACGGCAAGCAGAAGCCTCAGGGG + Intergenic
1171522236 20:25784687-25784709 ACAAAATGCAGAGGCAGCAGAGG - Intronic
1171529985 20:25846632-25846654 ACAAAATGCAGAGGCAGCAGAGG - Intronic
1171554591 20:26071196-26071218 ACAAAATGCAGAGGCAGCAGAGG + Intergenic
1173353442 20:42265571-42265593 AAGACAGGCAGCAGAGGCAGGGG - Intronic
1173469821 20:43314404-43314426 TGGAGATGCAGAAGAGGCAGAGG + Intergenic
1174436433 20:50510378-50510400 TTGACATGAAGAAGCAGCAGCGG + Exonic
1182947006 22:34333424-34333446 ACTACCTGCAGATGAGGCAGAGG - Intergenic
950090217 3:10289779-10289801 AGGTCAAGCAGAAGGGGCAGAGG - Exonic
950103539 3:10374111-10374133 ACGAACTGCAGAAGGCGCAGAGG + Intronic
952301768 3:32109676-32109698 ACAACATGGAGAAGCCCCAGAGG + Intronic
954687453 3:52378536-52378558 AGGACCTGCAGAGGCGGCAGAGG + Intronic
955878368 3:63518189-63518211 ATGAGATGAAGAAGAGGCAGAGG + Intronic
960066407 3:113378337-113378359 ACGACAGGCAGAAAGGGTAGAGG + Intronic
963061437 3:141230359-141230381 AGGACAATCAGAAGGGGCAGAGG + Intronic
963862660 3:150327142-150327164 AGGAGAAGCAGAAGAGGCAGTGG - Intergenic
967080013 3:186041222-186041244 ACATCATGCAGAAGGGGCGGGGG + Intergenic
973713503 4:53652351-53652373 AAGCCTTGCAGAAGGGGCAGGGG - Intronic
974667689 4:64986325-64986347 AGGACATGCAAAAAAGGCAGGGG - Intergenic
975639935 4:76490360-76490382 CTGACATGCAGAAAAGGCAGGGG + Intronic
975939344 4:79623265-79623287 AGGACATGGAGAAGCGACACAGG - Intergenic
976572651 4:86631300-86631322 AAGAAATGCAGAAGCTGAAGAGG - Intronic
979145823 4:117246567-117246589 AAGAAATGCAGAGGAGGCAGAGG + Intergenic
983238641 4:165207461-165207483 TCCAGAAGCAGAAGCGGCAGCGG + Intronic
987006330 5:13713952-13713974 ATGAGATGAAGAAGCTGCAGAGG + Intronic
994705943 5:103206800-103206822 ACGACATGCAGTCCAGGCAGAGG + Intronic
997843478 5:137264066-137264088 ACGACAATCAGAAGCTGCATGGG + Intronic
1004842218 6:19600077-19600099 ACGAAATCCAGGAGAGGCAGTGG + Intergenic
1005825084 6:29627733-29627755 ATCACAACCAGAAGCGGCAGTGG + Intronic
1006145216 6:31954834-31954856 ACCAGATGGAGAAGAGGCAGAGG - Exonic
1015175238 6:130299746-130299768 ACCACATTCAGAAGTGACAGAGG + Intronic
1015767356 6:136732650-136732672 ACGACATGCAGAAGCTCAGGTGG - Intronic
1018933556 6:168258466-168258488 ACTAAATGCAAAAGCTGCAGGGG + Intergenic
1020045063 7:5034435-5034457 ACGACCTGTAGGAGAGGCAGGGG + Intronic
1021665539 7:22974613-22974635 AAGCCATGCAGAATCAGCAGAGG - Intronic
1027218017 7:76196696-76196718 AAGACATAGAGAAGCGGCCGAGG + Intergenic
1031414484 7:121479343-121479365 ATGTGATGCAGAAGTGGCAGTGG - Intergenic
1034252572 7:149704034-149704056 GGGACATGCAGAACCAGCAGCGG + Intergenic
1035435520 7:158856597-158856619 CCGACAAGCAGGAGCAGCAGAGG - Exonic
1036127443 8:6075865-6075887 CCGACATCCACAAGCAGCAGTGG + Intergenic
1037585511 8:20273321-20273343 ACGCCGTGCAGAAGGAGCAGAGG - Intronic
1039428359 8:37505571-37505593 AAGCCAGGCAGAAGGGGCAGAGG - Intergenic
1043795266 8:84529516-84529538 GCGACATGCAAGAGCTGCAGTGG + Exonic
1046729063 8:117705648-117705670 AGGACATGCAGAAGCGTGGGAGG - Intergenic
1049180193 8:141218242-141218264 ACGACATGCAGAAGCGGCAGCGG - Exonic
1050865290 9:10489636-10489658 AAGACTTGCAGCAGCTGCAGAGG - Intronic
1057037102 9:91818923-91818945 ATGACCTGCAGAAGAGGGAGGGG - Intronic
1188450560 X:30303973-30303995 AAGACATGCAGAAGTGAAAGAGG - Intergenic
1190155881 X:47992146-47992168 ACACCATGCAGATGCAGCAGGGG + Intronic
1198394852 X:136210418-136210440 ACGACATGCAAGAGTTGCAGCGG + Exonic