ID: 1049180198

View in Genome Browser
Species Human (GRCh38)
Location 8:141218290-141218312
Sequence CTTGATCAGCACCACGGCGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 38}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049180195_1049180198 19 Left 1049180195 8:141218248-141218270 CCGCTTCTGCATGTCGTACAGGT 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 38
1049180193_1049180198 25 Left 1049180193 8:141218242-141218264 CCGCTGCCGCTTCTGCATGTCGT 0: 1
1: 0
2: 0
3: 1
4: 88
Right 1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049180198 Original CRISPR CTTGATCAGCACCACGGCGT TGG Exonic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
918649559 1:186944366-186944388 CTTGATTAGCGCCATGGCCTGGG - Intronic
922004694 1:221517955-221517977 CATGTTCAGCACCACAGCCTGGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067313194 10:45134688-45134710 CTTGAACACAACCACGGAGTTGG + Intergenic
1073261951 10:102197150-102197172 CTTAATCAGCACCAAGTCATTGG + Intergenic
1076026310 10:127117326-127117348 CTCAATCAGCACCACGGCGGTGG - Intronic
1077404016 11:2374727-2374749 CTTGCTCAGCAGCCCGGCCTGGG - Intergenic
1084414189 11:69021408-69021430 CTTGATCAGAAGCAATGCGTGGG + Intergenic
1085232942 11:74988775-74988797 CTCGGTCCCCACCACGGCGTGGG - Exonic
1111586672 13:90291299-90291321 CTTAATCAGCACCAAGTCGCCGG - Intergenic
1113929448 13:113958612-113958634 CGTGAACAGAAACACGGCGTGGG + Intergenic
1116228473 14:42183890-42183912 CTTGATATGCACCACTGAGTTGG + Intergenic
1121254330 14:92520193-92520215 CTTGACCACAACCACGGCCTAGG - Intronic
1127222617 15:56896222-56896244 CTTGACCAACACCACTGCTTTGG + Intronic
1128308585 15:66616298-66616320 CTTGATCAGGACCACACAGTTGG - Intronic
1140124324 16:72107414-72107436 CTTGAGCAGCAGCACCACGTTGG - Exonic
1147200634 17:38799391-38799413 CTGCACCAGCACCACGGCGGTGG - Exonic
1157546550 18:48550528-48550550 CATGGTCAGCCCCACGGCCTGGG - Intronic
926109565 2:10173391-10173413 CCTGATCCCCACCACTGCGTTGG + Intronic
1169211557 20:3768497-3768519 CTCGCTCAGCACCGCGGGGTGGG + Intergenic
1171017486 20:21555148-21555170 CTGGATCAGTGCCAGGGCGTTGG - Intergenic
1173983062 20:47239773-47239795 CTAGATCAGTACCATTGCGTTGG - Intronic
1176252249 20:64131065-64131087 CTTGTTCAGCACAAGGGCGATGG + Intergenic
1177177269 21:17713733-17713755 CTTTATCAGCACCACGGAAACGG - Intergenic
957542667 3:81593907-81593929 CTTTATCATCACCATGGAGTGGG - Exonic
963262511 3:143207123-143207145 CATAACCAGCACCACGGCATAGG - Intergenic
967480406 3:189966248-189966270 CCTGACCAGCACCAGGGAGTGGG - Intronic
986656852 5:10021301-10021323 GTTGAGCAGCACCACAACGTAGG + Intergenic
1002972688 6:2040298-2040320 GTTGATCAGCACCAGGTGGTGGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017989105 6:159470887-159470909 CTTGAGCAGCACCACCGCCGTGG + Intergenic
1019165203 6:170094012-170094034 CTCGATCAGAACCACAGCCTGGG + Intergenic
1022416166 7:30178960-30178982 TTTGCTCAGCACCAAGGCCTGGG - Intergenic
1033063594 7:138130721-138130743 CTAGAACAGCACCACGGGGGTGG + Intergenic
1041830160 8:62144449-62144471 CTTGCCCAGCAGCACGTCGTAGG - Intergenic
1047814786 8:128451695-128451717 CTTATTCAGCACCACGTCTTTGG - Intergenic
1049180198 8:141218290-141218312 CTTGATCAGCACCACGGCGTTGG + Exonic
1185835571 X:3343786-3343808 CAGGATCAGCACCACGGAGAGGG + Exonic
1186486720 X:9939266-9939288 CTTGATCAGCAGCTCCGCCTTGG - Exonic