ID: 1049183106

View in Genome Browser
Species Human (GRCh38)
Location 8:141233508-141233530
Sequence CTATTTTTGCTGCAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049183106_1049183110 -8 Left 1049183106 8:141233508-141233530 CCCACCACCTGCAGCAAAAATAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1049183110 8:141233523-141233545 AAAAATAGAAAACAATTAGCCGG No data
1049183106_1049183116 29 Left 1049183106 8:141233508-141233530 CCCACCACCTGCAGCAAAAATAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1049183116 8:141233560-141233582 ACCTGTAATCCCAGCTACTTGGG 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
1049183106_1049183113 1 Left 1049183106 8:141233508-141233530 CCCACCACCTGCAGCAAAAATAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1049183113 8:141233532-141233554 AAACAATTAGCCGGGCATGGTGG 0: 132
1: 11855
2: 73731
3: 177877
4: 210052
1049183106_1049183111 -7 Left 1049183106 8:141233508-141233530 CCCACCACCTGCAGCAAAAATAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1049183111 8:141233524-141233546 AAAATAGAAAACAATTAGCCGGG 0: 8
1: 559
2: 17333
3: 28893
4: 52764
1049183106_1049183115 28 Left 1049183106 8:141233508-141233530 CCCACCACCTGCAGCAAAAATAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1049183115 8:141233559-141233581 CACCTGTAATCCCAGCTACTTGG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
1049183106_1049183112 -2 Left 1049183106 8:141233508-141233530 CCCACCACCTGCAGCAAAAATAG 0: 1
1: 0
2: 0
3: 11
4: 180
Right 1049183112 8:141233529-141233551 AGAAAACAATTAGCCGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049183106 Original CRISPR CTATTTTTGCTGCAGGTGGT GGG (reversed) Intronic
901126838 1:6935375-6935397 TTTTTTTTGCTGCAGGTGCCAGG - Intronic
901130607 1:6960558-6960580 TTAATTTTGCTTCAGGCGGTGGG - Intronic
902142913 1:14371414-14371436 CTATCTCAGCTGCAGGGGGTGGG - Intergenic
907142252 1:52198573-52198595 CTAATTTTACTGCAAGTGTTAGG + Intronic
907309011 1:53528827-53528849 CTATGCTTCCTGCAGGTGTTTGG - Intronic
908439265 1:64137095-64137117 TTATTTTCGCAGCTGGTGGTGGG - Intronic
912757483 1:112336557-112336579 CTAACTTTACTGCAGGTGTTGGG - Intergenic
915977972 1:160402887-160402909 CTCTTTTTGCTGCCAGTGGCTGG + Intronic
916705287 1:167342996-167343018 CTATCTTTCCTACAGGTGTTTGG - Intronic
917838151 1:178957075-178957097 TTATTTTTGGTGGAGGTGGCAGG + Intergenic
918291073 1:183108385-183108407 CTGATTTTGCTGTAGGTGGCAGG + Exonic
921044487 1:211464677-211464699 TTGTTTTTGCTGCAAGTGTTTGG + Intergenic
921972705 1:221167709-221167731 CTATGTTTCCAGTAGGTGGTGGG + Intergenic
922089866 1:222385766-222385788 CTCTTTTGGCTGAGGGTGGTGGG - Intergenic
1062778398 10:175897-175919 CGATTTTTACTTCTGGTGGTAGG - Intronic
1064984324 10:21194818-21194840 ATTTTTTTGCGGCAGGGGGTGGG - Intergenic
1065876041 10:29997946-29997968 CTATGTGTGCTGCACGTGGGAGG - Intergenic
1067334732 10:45351172-45351194 CTATTTTTTCTCCATGTTGTCGG + Intergenic
1068156966 10:53212368-53212390 CTGTTTTTGCTTCAGGTACTTGG + Intergenic
1069286010 10:66716391-66716413 CTTATTTTGCAGCAGGTGGGTGG - Intronic
1069890909 10:71651993-71652015 CTATCCCTGCTGCAGGGGGTGGG + Intronic
1070686974 10:78491986-78492008 CTTTTATTGCTGCAGGCTGTGGG - Intergenic
1071435636 10:85646356-85646378 ATGATTTTGCTGCTGGTGGTGGG - Intronic
1073758049 10:106602219-106602241 ATATTTATTCTGAAGGTGGTAGG + Intronic
1073930710 10:108571357-108571379 ATATTTTTGAAGCAGGTGCTAGG - Intergenic
1074318582 10:112380491-112380513 GTATTTCTGCTGGAGGTGGAGGG - Intronic
1074572630 10:114638061-114638083 CTATTTTTGCAAAAGGTTGTGGG + Intronic
1075178480 10:120187686-120187708 CTTTTTTTGCTGCATGTTGGCGG - Intergenic
1077823055 11:5770189-5770211 CTATTTTTTCTCCATGTTGTCGG - Intronic
1078086994 11:8239843-8239865 CTATGGTGGCTGCAGGTGCTGGG - Intronic
1080700057 11:34637175-34637197 CTATTTTGGCTGCTGGTCGGTGG - Intronic
1083055825 11:59818742-59818764 CAGTTTATGCAGCAGGTGGTAGG + Intergenic
1083367826 11:62152124-62152146 GTGTTTCTGCTGCAGGTGGCAGG + Exonic
1084850139 11:71932461-71932483 CTATTTGTGCTCTAGGGGGTGGG + Intronic
1085554749 11:77410316-77410338 CCATCTTTGCTGGTGGTGGTGGG - Intronic
1087948086 11:104189325-104189347 GTATTTCTGCTGCAGCTGATTGG - Intergenic
1090662889 11:128894350-128894372 CTATTTAGGCTGGAGGTGGAAGG + Intronic
1092197871 12:6560780-6560802 GTATCTTTTCTCCAGGTGGTGGG - Exonic
1094028096 12:25980399-25980421 CTATGTTTTCTGCATGGGGTAGG + Intronic
1094138182 12:27151543-27151565 CAGTTATTTCTGCAGGTGGTAGG + Intergenic
1095987649 12:48010342-48010364 CTTTTTTTAAAGCAGGTGGTGGG + Intergenic
1096651136 12:53062488-53062510 CTGCTTTGGCTGCAGGGGGTAGG - Intronic
1097029261 12:56079911-56079933 CTAATTTTTCTGCAGGAGATAGG - Exonic
1099082097 12:78196994-78197016 TTATATTTGCTGCAGGTGTTTGG + Intronic
1099636762 12:85223365-85223387 CTTTTTTTTCTGCAGGTCTTTGG - Intronic
1100131871 12:91504292-91504314 CTCTTTCTACTGCAGGTAGTGGG + Intergenic
1104602832 12:130164464-130164486 ATCTTTATGCTGCTGGTGGTGGG + Exonic
1104633021 12:130420504-130420526 CTACTTTTGATGAATGTGGTTGG - Intronic
1105638719 13:22240702-22240724 CTTATTTTGCTGCGGGGGGTGGG - Intergenic
1106451930 13:29889944-29889966 TTATTTTTGCTGCAGGTGCAGGG + Intergenic
1110719569 13:78746262-78746284 GTATTCTTGCTGGAGGGGGTTGG - Intergenic
1112219946 13:97478221-97478243 CTATTTTTTCTTCATCTGGTTGG - Intergenic
1112822746 13:103355432-103355454 CTCTTGTAGCTGCTGGTGGTTGG - Intergenic
1114045862 14:18875343-18875365 CTCTTTCTGCTGCAGGCCGTGGG - Intergenic
1114118352 14:19644127-19644149 CTCTTTCTGCTGCAGGCCGTGGG + Intergenic
1114287990 14:21263575-21263597 CTATTTTTTCTGCAGCAGTTGGG - Intronic
1117387727 14:55232777-55232799 TTATTTTTTTTGCAGGGGGTTGG + Intergenic
1117448271 14:55825960-55825982 CTATTTTTTTTCCAGATGGTTGG + Intergenic
1117837843 14:59826028-59826050 CTCTTTTTGATCCAGGTGTTGGG - Intronic
1119084989 14:71731355-71731377 AGATTTTAGCTGCAGGTGGATGG - Intronic
1119705141 14:76778693-76778715 CTAATCTGGCTGCAGTTGGTAGG - Intronic
1120620682 14:86760699-86760721 CTATTTTTGCTTCAATTGATAGG + Intergenic
1122535068 14:102456204-102456226 CTTTGTTAGCTGCTGGTGGTGGG + Intronic
1124117271 15:26857178-26857200 CTATTTTTTCTGCTTGTGTTGGG - Intronic
1127429685 15:58891368-58891390 TTATTTTTGCTTAAGGTGTTTGG - Intronic
1127648043 15:60976841-60976863 CTGTTGCTGCTGCAGGTGGTGGG - Intronic
1128018792 15:64371915-64371937 CCATTTTTTGTGCAGGAGGTGGG - Intronic
1130235687 15:82131465-82131487 ATTTTTTTTCTGGAGGTGGTGGG + Intronic
1132258321 15:100398110-100398132 CTTTTTTTGTGGCGGGTGGTGGG + Intergenic
1133070585 16:3244132-3244154 CTACCTTTGCTCCAGGTGTTTGG + Intronic
1135283447 16:21172748-21172770 CTGATTCTGATGCAGGTGGTTGG + Intronic
1135973545 16:27089741-27089763 CTATTGATGCTGTAGGTGATGGG - Intergenic
1136743896 16:32565975-32565997 CTATTTTTGATTCAGCTGGTTGG + Intergenic
1141909298 16:87047647-87047669 CTTTTTTTTCTGCAGGAGGGTGG - Intergenic
1203025702 16_KI270728v1_random:509258-509280 CTATTTTTGATTCAGCTGGTTGG - Intergenic
1203046019 16_KI270728v1_random:825173-825195 CTATTTTTGATTCAGCTGGTTGG + Intergenic
1144210839 17:13013971-13013993 CTATTTTTACAGCATGAGGTGGG + Intronic
1145222024 17:21097280-21097302 CTTTTTTTGCTGGTGGTGGAAGG + Intergenic
1147537972 17:41333268-41333290 CAATGTTTGCAGGAGGTGGTGGG + Intergenic
1149836961 17:59921727-59921749 ATATTTTTGCTGCAACTGGTAGG - Intronic
1151289983 17:73142782-73142804 TTATTTTTTCTGGGGGTGGTGGG - Intergenic
1151994842 17:77602035-77602057 GTATTTGTGCTGAAGATGGTGGG + Intergenic
1153863152 18:9234377-9234399 CAGTTTGTGCTGCTGGTGGTGGG + Intronic
1155816364 18:30316291-30316313 CCAATTTTGCTGGGGGTGGTTGG - Intergenic
1156858688 18:41812580-41812602 CTATGTTGGCTGGAGGTGGTGGG + Intergenic
1157740474 18:50088356-50088378 CTATTTTTCCTGTGTGTGGTAGG - Intronic
1159469213 18:68828064-68828086 CTGTTTTTGCTTCATGTGTTTGG - Intronic
1162872586 19:13597759-13597781 CCAGTTTTGTGGCAGGTGGTGGG + Intronic
1163362676 19:16857658-16857680 CTATTTTTGATGTGGGTGGTGGG - Intronic
1164425148 19:28134713-28134735 CTATTTCTGATTCGGGTGGTTGG + Intergenic
1167415771 19:49371109-49371131 TTGTTTTTTCTGCAGGTGCTGGG - Intronic
926712992 2:15898060-15898082 CTATATTTGTTTCAGGTGGGAGG - Intergenic
926861376 2:17313286-17313308 CTAGTTTTGCTGCAGTTGCCTGG - Intergenic
928920664 2:36523432-36523454 CTAGTTTTGCTCCAGATGTTAGG - Intronic
929153665 2:38770723-38770745 CTTTTTTTGGTGGTGGTGGTGGG + Intronic
929807586 2:45160621-45160643 CTATTTTTGATTCAGGTACTTGG - Intergenic
932332296 2:70904689-70904711 GCGTTTTTGCTGCTGGTGGTGGG - Intronic
932364299 2:71138317-71138339 CTATTTCTGCTGCCTATGGTGGG - Intronic
938623714 2:133085272-133085294 AAAATGTTGCTGCAGGTGGTAGG - Intronic
946023253 2:216656331-216656353 CTATTGTGGCTGCAGATGGAAGG + Intronic
948137039 2:235644156-235644178 CTGCTTCCGCTGCAGGTGGTTGG + Intronic
948612149 2:239176555-239176577 CTGTTGTTGCTGCAAGTGGAAGG + Exonic
1169937719 20:10902654-10902676 CTATTTTTCCTTCAGTTGGAAGG + Intergenic
1170907703 20:20530654-20530676 CTATTATAGCTGCATGTGGCAGG + Intronic
1172377547 20:34457109-34457131 TTATTCTTGCTGCTGTTGGTTGG + Intronic
1172659289 20:36556613-36556635 TGACTTTTGCTGCAGGTGCTGGG - Intergenic
1174579993 20:51564521-51564543 CTGTTCTTGCTTCAGATGGTTGG - Intergenic
1175424956 20:58857650-58857672 CTATTCTTCCTGGAGGTGGGGGG + Intronic
1175773845 20:61640996-61641018 CTACGTTTGCTGCACGTGGCTGG + Intronic
1176513178 21:7763866-7763888 TTATTTTTGGTGGTGGTGGTGGG + Intronic
1178647291 21:34394390-34394412 TTATTTTTGGTGGTGGTGGTGGG + Intronic
1179222874 21:39425267-39425289 ATATGTCTGCTCCAGGTGGTGGG + Intronic
1179225232 21:39447106-39447128 TTGTTTTTGCTGGTGGTGGTGGG + Intronic
1179539549 21:42075225-42075247 ATATTTTTGCTGGAGATGGGGGG + Intronic
1179639231 21:42736329-42736351 CTATTTTACCTGCAAGTGGCAGG + Intronic
1180464393 22:15597960-15597982 CTCTTTCTGCTGCAGGCCGTGGG - Intergenic
1180675250 22:17582001-17582023 TTATTTTTGTTGCTGCTGGTGGG - Intronic
1182894796 22:33850207-33850229 TTATTGCTGCTGCTGGTGGTAGG - Intronic
951190699 3:19767125-19767147 TTATTTTTGCCACAGCTGGTTGG - Intergenic
951686849 3:25354037-25354059 CTATTTTTGGTGGGGGTGGGGGG - Intronic
954015062 3:47681318-47681340 TTATTTTTGGTGGAGGTGCTGGG + Intronic
954218479 3:49137821-49137843 CTGGATTTGCTGCAGCTGGTGGG + Intergenic
956046115 3:65197808-65197830 TTATTTTTATTGCAGGTAGTTGG - Intergenic
956348263 3:68304954-68304976 CTATTTTTACTGCAGTTTGCAGG - Intronic
957461447 3:80526427-80526449 ATATTTTTGCTGCTTGTTGTGGG - Intergenic
958971465 3:100615348-100615370 CTATTTTTGCTGTATTTTGTGGG + Intronic
959293969 3:104512050-104512072 ATATTTTTACTGTGGGTGGTAGG - Intergenic
959808624 3:110589927-110589949 CAATTTTTGCTGCTGGTTATGGG + Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
963318851 3:143790344-143790366 CTTTTCTTACTGAAGGTGGTTGG - Intronic
966259340 3:177956458-177956480 CCATATTTTATGCAGGTGGTTGG + Intergenic
971531101 4:27690106-27690128 CTATTTTTGCTGCTTCTGGGAGG + Intergenic
975766769 4:77676821-77676843 CGATTTTTGTTGCAGATGGCGGG - Intergenic
977411107 4:96665318-96665340 CTACTTTTACTGGAGGTGGAGGG - Intergenic
982666758 4:158274413-158274435 CTATCTTTGCTGCATGTATTAGG + Intergenic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
985891689 5:2720573-2720595 CTGCTTTTGCTGCTGGTGCTGGG - Intergenic
987215317 5:15731025-15731047 CTATTTTTACTGCAACTGGGAGG + Intronic
988117772 5:26919622-26919644 CTAGTTGTGCTGTTGGTGGTTGG - Intronic
990637919 5:57750371-57750393 CCATTTCTGTTGGAGGTGGTGGG - Intergenic
991012444 5:61898327-61898349 CCATATTTGCTGGATGTGGTTGG + Intergenic
991975996 5:72184088-72184110 GTATTTATGCTGGGGGTGGTGGG + Intronic
997277199 5:132604669-132604691 GTATTTTTGTTGCAGTGGGTGGG + Intronic
998224759 5:140318380-140318402 CTCTCTTTGCTGAAGGGGGTGGG - Intergenic
998473277 5:142399934-142399956 CTATTTCTGCTGGACCTGGTAGG + Intergenic
1000658504 5:163911010-163911032 CTATTTTTGCTTCAGATATTAGG - Intergenic
1001926451 5:175640566-175640588 CTATATCTGCTGCAGGGCGTGGG - Intergenic
1003006770 6:2389801-2389823 CAATTTGTGTTGCAGGTTGTGGG - Intergenic
1004313401 6:14565477-14565499 CTGTTTTGGCTGGGGGTGGTAGG - Intergenic
1009957144 6:70469719-70469741 CTCTTTTTTTTGCAGGGGGTGGG - Intronic
1013281364 6:108640100-108640122 CCAGTCTTGCTGCAGGTAGTAGG + Intronic
1014382601 6:120761706-120761728 CTATTTTTTTTGGAGGGGGTAGG - Intergenic
1014819410 6:125970495-125970517 CTAATTTTGAAGCAGCTGGTAGG + Intronic
1018929543 6:168231740-168231762 TTCTTTTTCCTGCAGGTGGGTGG + Intergenic
1019465756 7:1187755-1187777 CTTTTTTTGGTGCAGGGGGATGG - Intergenic
1022055015 7:26721429-26721451 CTATTTTAGATGCAGATAGTTGG + Intronic
1023601559 7:41886197-41886219 CTATTAGTGCTGCAGGTGATAGG - Intergenic
1024084355 7:45881277-45881299 CTATCATTGCTGCAGCTGGGTGG - Intergenic
1025001115 7:55315361-55315383 CTATATTTGATGCATGTGGCAGG - Intergenic
1029286249 7:99468192-99468214 CTATATTTGCTGGGGTTGGTTGG - Intergenic
1030547639 7:110917576-110917598 CTATTTTTGCTGGAGGAGCATGG - Intronic
1032204348 7:129848784-129848806 TTATTTTTGGTGGTGGTGGTGGG + Intronic
1033593872 7:142840005-142840027 TTATTTTTTCTGCAGTTTGTAGG - Intergenic
1033713727 7:143977539-143977561 CTATTTTTGTGGAAAGTGGTGGG - Intergenic
1033818614 7:145106417-145106439 CTATCTTTGCTGCAGTTGAGTGG + Intergenic
1034988485 7:155532669-155532691 CTATTTTAGGAGGAGGTGGTAGG - Intronic
1037226631 8:16600306-16600328 CTATTGTTGCTGCAGGGATTCGG + Intergenic
1038129613 8:24715413-24715435 CTATTTTTGGCTCAGGTGGTTGG - Intergenic
1040343069 8:46453921-46453943 ATACTTTTGATGCAGGAGGTTGG - Intergenic
1040410802 8:47152594-47152616 CTATTTTTGCTTCTGTTGCTTGG - Intergenic
1046229220 8:111331590-111331612 ATATTTTTTATGTAGGTGGTAGG + Intergenic
1048765678 8:137841921-137841943 CTTTTGTGGCTGCATGTGGTGGG - Intergenic
1048833919 8:138500384-138500406 CTGGTTCTGCTGCAGGTGGAAGG + Intergenic
1049183106 8:141233508-141233530 CTATTTTTGCTGCAGGTGGTGGG - Intronic
1050589271 9:7145617-7145639 CAATTTTTGCTGCAATTGTTAGG + Intergenic
1052246748 9:26346357-26346379 TTTTTTTTTCTGCAGGTGGGAGG - Intergenic
1053034043 9:34809748-34809770 CTGTTCTTGCTGCAGTTGGCCGG + Intergenic
1053514534 9:38719244-38719266 CTACTTTTGCTGGGGGTGGGGGG - Intergenic
1058252930 9:102724472-102724494 ATATTTTTGCTGAAGGTACTTGG + Intergenic
1060152778 9:121299503-121299525 ATTTTTTTGCTGGAGGTGTTAGG + Intronic
1060173427 9:121479973-121479995 CTATTTTGGGAGCAGGAGGTGGG - Intergenic
1185766483 X:2729774-2729796 CTTTTTTTATTGCAGGAGGTGGG + Intronic
1186282243 X:8005499-8005521 CTAAATTTTCTGTAGGTGGTAGG + Intergenic
1186908088 X:14132806-14132828 GTAATGTTGCTGCAGCTGGTTGG - Intergenic
1189606892 X:42688067-42688089 CAATTTTGGCTGCAAGTGGAAGG - Intergenic
1190545910 X:51526620-51526642 TTATTTTTGCTGCTGTTGGGTGG - Intergenic
1192002699 X:67172261-67172283 CTTTTTTTGTTGATGGTGGTAGG + Intergenic
1196798935 X:119524841-119524863 CTCTTTTTGCCTCTGGTGGTGGG - Intergenic
1197346870 X:125334595-125334617 TAAGTTTTTCTGCAGGTGGTAGG + Intergenic
1200364464 X:155646823-155646845 CTATTTTGGATACAAGTGGTGGG + Intronic
1200436148 Y:3154155-3154177 CTATGTTTGCTGAAGGCGCTGGG + Intergenic
1201303374 Y:12529496-12529518 CCATTTTCTCTGCTGGTGGTGGG + Intergenic