ID: 1049184526

View in Genome Browser
Species Human (GRCh38)
Location 8:141242775-141242797
Sequence AACGTGTGGCCTCCAGTCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1049184526_1049184540 23 Left 1049184526 8:141242775-141242797 CCCGAGACTGGAGGCCACACGTT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1049184540 8:141242821-141242843 CTGGGTTTATACAAACACCGCGG No data
1049184526_1049184533 4 Left 1049184526 8:141242775-141242797 CCCGAGACTGGAGGCCACACGTT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1049184533 8:141242802-141242824 GAGCCCATCTACCACCATCCTGG No data
1049184526_1049184534 5 Left 1049184526 8:141242775-141242797 CCCGAGACTGGAGGCCACACGTT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1049184534 8:141242803-141242825 AGCCCATCTACCACCATCCTGGG No data
1049184526_1049184541 24 Left 1049184526 8:141242775-141242797 CCCGAGACTGGAGGCCACACGTT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1049184541 8:141242822-141242844 TGGGTTTATACAAACACCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1049184526 Original CRISPR AACGTGTGGCCTCCAGTCTC GGG (reversed) Intronic
900311051 1:2033292-2033314 CACCTGCGGCCTCCAGCCTCAGG - Intergenic
900342581 1:2195746-2195768 AACCTATGGCCTCCAGGCTGGGG - Intronic
901537477 1:9891881-9891903 AACCTCTGCCTTCCAGTCTCAGG + Intronic
901679377 1:10904274-10904296 ACCGTTTGGCCTCCAGACACTGG - Intergenic
904411698 1:30328720-30328742 AACGTCTGGTGTCCAGCCTCAGG - Intergenic
906237247 1:44219412-44219434 AACTTGATGCCTGCAGTCTCAGG - Exonic
915925175 1:160012023-160012045 ACCGTGCAGCCTCCAGTCTGGGG + Intergenic
920069967 1:203295843-203295865 CACCTGTGGCCTCCTGGCTCTGG - Intergenic
920200786 1:204258600-204258622 AAGCTGTGGCCTGCAGTCCCTGG + Intronic
920749256 1:208658546-208658568 ACCTTGTGTCCTCCAGTCACTGG - Intergenic
921465590 1:215483266-215483288 ACAGTGTGGCCTTCAGTCTGTGG + Intergenic
1062802476 10:390297-390319 AATGTGTGGGAACCAGTCTCGGG + Exonic
1067828301 10:49595410-49595432 AACGTTTGACCTCCAGTTCCGGG - Intergenic
1069096233 10:64262956-64262978 AACGTGTGGTTCCCAGTCTGGGG + Intergenic
1074901138 10:117817279-117817301 CACGTGTGCCCTTCAGTCCCAGG - Intergenic
1077219878 11:1411138-1411160 AGGGTGGGGGCTCCAGTCTCAGG + Exonic
1077904311 11:6517705-6517727 ATCATGAGGTCTCCAGTCTCAGG - Intronic
1083937507 11:65877762-65877784 AAAGTGTGGCCTCACGACTCTGG + Intergenic
1084358797 11:68656438-68656460 AACTTCTGGCCTCCAGACTGTGG + Intergenic
1095972508 12:47912331-47912353 AACTGGTGGCCTCCAGACCCTGG + Intronic
1096578309 12:52568649-52568671 TACTGGTGGCCTCCGGTCTCAGG - Intronic
1101844699 12:108353466-108353488 AACGTGTGGCCTTTTGTGTCTGG - Intergenic
1102181950 12:110919473-110919495 AAGGTGTGGCCTCCATCCCCAGG - Intronic
1103443800 12:120981116-120981138 AAAGTGGGGCCTCCAGCGTCAGG + Intronic
1103730412 12:123023481-123023503 AACATGTTGCTTCCAGTCCCTGG - Intronic
1104397439 12:128446439-128446461 AATGTGTGGCCTCCAGAGTCAGG - Intronic
1104431290 12:128718436-128718458 ACAGTGTGGCCTTCAGTCTGTGG - Intergenic
1107496122 13:40927550-40927572 AACTTCTGGCCTCCTGTCTCAGG - Intergenic
1113857226 13:113453912-113453934 AATGTGTGGCCTTCGGTGTCTGG + Intergenic
1114206855 14:20580008-20580030 AAAGTGTGGCCTACAGAATCAGG + Intergenic
1119427560 14:74545725-74545747 ACCGTGTGTTCTCCAGACTCTGG + Intronic
1120187205 14:81406111-81406133 ACAGTGTGGCCTTCAGTCTGTGG - Intronic
1122344800 14:101051839-101051861 ATGCTGTGGCCTCCAGGCTCTGG + Intergenic
1122644911 14:103187929-103187951 ACCATGTGGCCTCCTGTCTCTGG - Intergenic
1122759763 14:104014359-104014381 AACCGCTGCCCTCCAGTCTCAGG + Intronic
1124594953 15:31084459-31084481 AACGTGTGGCCTTTTGTGTCTGG + Intronic
1127196040 15:56586926-56586948 AACCTGTGGCCTACAGTAGCAGG - Intergenic
1128550422 15:68594801-68594823 AACCTCTTGCCTCCAGTCCCAGG + Intronic
1129942686 15:79512209-79512231 AGTGTGTGGGCTCCAGGCTCAGG - Intergenic
1132710267 16:1263235-1263257 CACCTGTGGCCTCCAGACCCAGG - Intergenic
1132854493 16:2038734-2038756 GACGTGGGGCCTCCATCCTCAGG - Exonic
1135380529 16:21992708-21992730 ACAGTGTAGCCTCCAGTCTGTGG - Intronic
1138916164 16:61467342-61467364 AACCTTTGTTCTCCAGTCTCGGG - Intergenic
1139323404 16:66133550-66133572 CACCTGTGGACTCCAGTCGCTGG - Intergenic
1140934698 16:79659539-79659561 AACGTGAAGCCACGAGTCTCAGG - Intergenic
1141816848 16:86416529-86416551 AACGTGTGGCCTTTTGTGTCTGG - Intergenic
1143491265 17:7286504-7286526 AACGTCCGGCCTCGAGTTTCAGG - Exonic
1147920846 17:43916112-43916134 AACTTGAGGCCTGCAGCCTCAGG + Intergenic
1147947550 17:44088540-44088562 AACGTGTGGCCACCAGCATGCGG - Exonic
1148775319 17:50091925-50091947 AAAGTGTGGTCTCCATTCACTGG - Intergenic
1152314009 17:79569330-79569352 AACGTGTGGCCTTTTGTGTCTGG + Intergenic
1152792608 17:82289932-82289954 GAAGTGTGGCCTCCAGCCTAAGG + Intergenic
1160168008 18:76530656-76530678 AACGCCTGGCCTCCTGCCTCAGG - Intergenic
1161516598 19:4699969-4699991 GCGGCGTGGCCTCCAGTCTCAGG + Intronic
1161838440 19:6664088-6664110 GAGGTGTGGCCACCAGTCTGTGG + Intronic
1167487384 19:49770712-49770734 AACACGTGGCCTCCTGTGTCTGG - Intronic
1168152142 19:54454956-54454978 AACTTGAGACCTCCAGTCCCAGG - Exonic
926789150 2:16552411-16552433 CACGTGTGGACTGCAGTCTGAGG + Exonic
928240904 2:29585007-29585029 AACGTGTGGCTTCCTCTCTCAGG + Intronic
928294972 2:30074601-30074623 AACGTCGGGCTTCCAGGCTCTGG - Intergenic
930160893 2:48155469-48155491 GTCTTGTGGACTCCAGTCTCAGG - Intergenic
933991015 2:87633880-87633902 CAGGTGTGGCCTCCAGCCTCAGG - Intergenic
936302824 2:111316943-111316965 CAGGTGTGGCCTCCAGCCTCAGG + Intergenic
937100493 2:119264540-119264562 GACGTCTGTCCTCCAGTCACAGG + Exonic
939021225 2:136960630-136960652 AACATGTGGCCTTTAGTGTCAGG + Intronic
942732345 2:179074224-179074246 ACAGTGTGGCCTTCAGTCTGTGG - Intergenic
1172028717 20:31967382-31967404 AAGATATGCCCTCCAGTCTCAGG + Intergenic
1175584493 20:60127173-60127195 ACCATGTGGCCCCCAGTCTGAGG - Intergenic
1179909655 21:44441131-44441153 ACCCTGTAGCCTCCAGTTTCTGG - Intronic
1182354619 22:29717022-29717044 AAGGAGTGGGCTCCAGTCTCAGG + Intergenic
1182487795 22:30649664-30649686 TACCTCTGGCCTCCACTCTCAGG + Intronic
1183947620 22:41335668-41335690 AATGTGTGCACTTCAGTCTCCGG - Intronic
1184810558 22:46828682-46828704 GAGGTGTGGCCTCCTGTCCCAGG - Intronic
1185153455 22:49179527-49179549 ACTGTGTGGCCTCCTGTCTCTGG + Intergenic
950289396 3:11771308-11771330 AACCTGTGGCCTCCAGGGACGGG + Intergenic
953606339 3:44415516-44415538 AACATGTGGCCTCCATCCTGTGG - Intergenic
958980458 3:100712966-100712988 ATCATCTGGCCTCCAGTCCCTGG - Intronic
964776779 3:160287812-160287834 AAATTATGGCCTCTAGTCTCAGG + Intronic
968805291 4:2768006-2768028 GGCGTGTGGCCTGCAGGCTCTGG + Intergenic
969719982 4:8888270-8888292 AAGGGGTGGCCTCCTCTCTCTGG - Intergenic
974665750 4:64959500-64959522 AACATTTGGCCTCCAGCCTTAGG - Intergenic
976518447 4:85998830-85998852 AAGGTGAGGCCTCCAGTATTAGG - Intronic
996391877 5:122971096-122971118 ACAGTGTAGCCTTCAGTCTCTGG + Intronic
998041973 5:138956318-138956340 AATGTGTGGCCTCCATCATCTGG + Intronic
999811730 5:155133826-155133848 AATGGGTTGCCTCCATTCTCTGG + Intergenic
1003216581 6:4118815-4118837 ACCGAGTGGCCTCCAAACTCAGG + Intronic
1003550702 6:7100007-7100029 AAAGTGTGGGCTCCAGGGTCAGG + Intergenic
1011543503 6:88458999-88459021 AATGTGTGGCATCCAATTTCTGG + Intergenic
1013389595 6:109669936-109669958 AGGGTGTGGCCCCCAGACTCAGG + Intronic
1016782439 6:147974291-147974313 GACGTGTGACTTCCAGTCTTGGG - Intergenic
1017165984 6:151408797-151408819 TATGGGTGGCCTCCAGTCACTGG + Intronic
1017228259 6:152044565-152044587 ACAGTGCGGCCTTCAGTCTCTGG + Intronic
1017291700 6:152745047-152745069 GACATGTGGCCTCCAGGGTCAGG + Intergenic
1018170328 6:161139180-161139202 AACGTGTGGAATCCAGCCCCAGG + Intronic
1018268784 6:162054295-162054317 AAAGTGTGGTCTGCAGACTCTGG + Intronic
1019291926 7:254850-254872 GACGTGTGGCCTCCTCTGTCTGG + Intronic
1023159535 7:37283943-37283965 AAGCTGTGGCCTCCAGTTTGAGG - Intronic
1027246476 7:76371045-76371067 AAGGTTTGGCCTCCAGCCCCAGG + Intergenic
1028787299 7:94810176-94810198 ACAGTGTGGCCTTCAGTCTGCGG + Intergenic
1034875662 7:154722718-154722740 TACGTGTGGCCTTCACTATCTGG - Intronic
1040527335 8:48236563-48236585 AATGTGTGGCCTGCAGTGTAGGG + Intergenic
1041500465 8:58533962-58533984 TACATGTGACCTCCAGTCCCTGG + Intergenic
1044212971 8:89572495-89572517 AAGGTGTAGCATCCACTCTCAGG + Intergenic
1049184526 8:141242775-141242797 AACGTGTGGCCTCCAGTCTCGGG - Intronic
1050498308 9:6267287-6267309 AAAGTGTGGCCTTCAGTCTGAGG - Intergenic
1051285990 9:15497293-15497315 AACGTGTGGTCTTCAGTGGCTGG - Intronic
1052749851 9:32478639-32478661 AACGTCTGCCTTCCAGGCTCAGG + Intronic
1056825020 9:89871043-89871065 AACATGTGGCCTTCTGTGTCTGG - Intergenic
1186882004 X:13875763-13875785 AACATGTGGCCTACCGTGTCTGG - Intronic
1192998615 X:76539296-76539318 AAAATGTGGGCTCCAGTCCCAGG - Intergenic
1193940622 X:87677366-87677388 ACGGTGTGGCCTTCAGTCTGTGG + Intergenic
1197055828 X:122117174-122117196 AATATGTGACCTCTAGTCTCAGG + Intergenic
1197286708 X:124603579-124603601 AAAGTGTGGGCTCCAGCATCAGG - Intronic
1197372442 X:125641339-125641361 ACGGTGTGGCCTTCAGTCTGTGG + Intergenic
1198220641 X:134598408-134598430 AAGATGTGGCCTCGACTCTCAGG + Intronic
1200251619 X:154557181-154557203 AACGCGTGGCCTCCCGCTTCTGG + Intronic
1200253826 X:154568865-154568887 AACGCGTGGCCTCCCGCTTCTGG + Intergenic
1200263943 X:154635543-154635565 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1200266148 X:154647235-154647257 AACGCGTGGCCTCCCGCTTCTGG - Intergenic
1202246218 Y:22822997-22823019 CAGCTGTGGCCTCAAGTCTCTGG - Intergenic
1202399206 Y:24456745-24456767 CAGCTGTGGCCTCAAGTCTCTGG - Intergenic
1202471574 Y:25213341-25213363 CAGCTGTGGCCTCAAGTCTCTGG + Intergenic